Transcript: Mouse XR_374416.1

PREDICTED: Mus musculus histocompatibility 13 (H13), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
H13 (14950)
Length:
1552
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_374416.1
NBCI Gene record:
H13 (14950)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_374416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030531 GTGGCCGAGATGTTCAGTTAT pLKO.1 1105 3UTR 100% 13.200 17.160 N H13 n/a
2 TRCN0000278762 GTGGCCGAGATGTTCAGTTAT pLKO_005 1105 3UTR 100% 13.200 17.160 N H13 n/a
3 TRCN0000030530 GAGATCATCAACTATGAGTTT pLKO.1 599 3UTR 100% 4.950 3.465 N H13 n/a
4 TRCN0000278816 GAGATCATCAACTATGAGTTT pLKO_005 599 3UTR 100% 4.950 3.465 N H13 n/a
5 TRCN0000030532 CACCATCTTCATCATGCACAT pLKO.1 999 3UTR 100% 4.050 2.835 N H13 n/a
6 TRCN0000297557 CACCATCTTCATCATGCACAT pLKO_005 999 3UTR 100% 4.050 2.835 N H13 n/a
7 TRCN0000030529 CCAGGAGTACATCAACCTCTT pLKO.1 436 3UTR 100% 4.050 2.835 N H13 n/a
8 TRCN0000297555 CCAGGAGTACATCAACCTCTT pLKO_005 436 3UTR 100% 4.050 2.835 N H13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_374416.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04234 pDONR223 100% 61% None (many diffs) n/a
2 ccsbBroad304_04234 pLX_304 0% 61% V5 (many diffs) n/a
3 TRCN0000470515 TAATGTGCCTTCAAACGGCCTTCC pLX_317 37.9% 61% V5 (many diffs) n/a
4 TRCN0000492118 TAGAATGGAGCGGACGGCAGTAGG pLX_317 31.7% 61% V5 (many diffs) n/a
5 TRCN0000488993 TTATAGCGGGGCCCCGTCGCTGGC pLX_317 30.2% 61% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV