Transcript: Mouse XR_375494.1

PREDICTED: Mus musculus natriuretic peptide receptor 1 (Npr1), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Npr1 (18160)
Length:
2533
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_375494.1
NBCI Gene record:
Npr1 (18160)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_375494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000361263 TTGCCAAGACAGCATACTATA pLKO_005 2071 3UTR 100% 13.200 10.560 N Npr1 n/a
2 TRCN0000361264 ACTTACAAAGAACCCGATAAT pLKO_005 1350 3UTR 100% 13.200 9.240 N Npr1 n/a
3 TRCN0000361262 ATCGTGTCTTTCTTCATATAC pLKO_005 1875 3UTR 100% 13.200 9.240 N Npr1 n/a
4 TRCN0000028829 GCGACTCAACATCACAGTAAA pLKO.1 1040 3UTR 100% 13.200 9.240 N Npr1 n/a
5 TRCN0000028818 CCCTAAATGTGGCTTTGACAA pLKO.1 1769 3UTR 100% 4.950 3.465 N Npr1 n/a
6 TRCN0000028807 GCTGTGTCAGAACACAGATTA pLKO.1 1716 3UTR 100% 1.320 0.924 N Npr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_375494.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488907 AGGCGTGCCGTTCCACTCACTATC pLX_317 11.4% 49.7% V5 (many diffs) n/a
2 TRCN0000487819 TTAACACTCCCCGGCGCAGTGGAG pLX_317 7.8% 49.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_13913 pDONR223 100% 49.6% None (many diffs) n/a
4 ccsbBroad304_13913 pLX_304 0% 49.6% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV