Transcript: Mouse XR_377104.1

PREDICTED: Mus musculus syntaxin 1A (brain) (Stx1a), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Stx1a (20907)
Length:
2368
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_377104.1
NBCI Gene record:
Stx1a (20907)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_377104.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000380092 TCCACGCTGTCCCGAAAGTTT pLKO_005 455 3UTR 100% 5.625 7.875 N Stx1a n/a
2 TRCN0000110581 CGCTCCAAGCTAAAGAGCATT pLKO.1 362 3UTR 100% 4.950 6.930 N Stx1a n/a
3 TRCN0000380322 GACTACCGAGAACGCTGCAAA pLKO_005 512 3UTR 100% 4.950 6.930 N Stx1a n/a
4 TRCN0000236763 GGAGCTCATGTCGGACATTAA pLKO_005 322 3UTR 100% 13.200 10.560 N Stx1a n/a
5 TRCN0000236762 ACCACGACCAGTGAGGAATTG pLKO_005 569 3UTR 100% 10.800 7.560 N Stx1a n/a
6 TRCN0000236765 CAAAGTTCGCTCCAAGCTAAA pLKO_005 355 3UTR 100% 10.800 7.560 N Stx1a n/a
7 TRCN0000236764 GCCTAGTGACCCTTTACTAAG pLKO_005 1803 3UTR 100% 10.800 7.560 N Stx1a n/a
8 TRCN0000230305 TTGACAGGATCGAGTACAATG pLKO_005 990 3UTR 100% 10.800 7.560 N STX1A n/a
9 TRCN0000236766 TTGACAGGATCGAGTACAATG pLKO_005 990 3UTR 100% 10.800 7.560 N Stx1a n/a
10 TRCN0000110580 GCTCAGCACTGAGTCTTTGTT pLKO.1 1655 3UTR 100% 5.625 3.938 N Stx1a n/a
11 TRCN0000381307 GGAGGTCATGTCCGAGTACAA pLKO_005 478 3UTR 100% 4.950 3.465 N Stx1a n/a
12 TRCN0000110583 GATGATTGACAGGATCGAGTA pLKO.1 985 3UTR 100% 4.050 2.835 N Stx1a n/a
13 TRCN0000110584 ACGACCAGTGAGGAATTGGAA pLKO.1 572 3UTR 100% 3.000 2.100 N Stx1a n/a
14 TRCN0000110582 CGCTTCATGGATGAATTCTTT pLKO.1 176 3UTR 100% 0.000 0.000 N Stx1a n/a
15 TRCN0000381955 CTTTGCCTCTGGGATCATCAT pLKO_005 622 3UTR 100% 4.950 2.970 N STX1A n/a
16 TRCN0000065011 AGGATCGAGTACAATGTGGAA pLKO.1 995 3UTR 100% 2.640 1.848 N STX1A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_377104.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07013 pDONR223 100% 33.3% None (many diffs) n/a
2 ccsbBroad304_07013 pLX_304 0% 33.3% V5 (many diffs) n/a
3 TRCN0000481524 AGCCGTACAACCACTACAGACGTG pLX_317 60.1% 33.3% V5 (many diffs) n/a
Download CSV