Transcript: Mouse XR_378781.2

PREDICTED: Mus musculus RNA binding protein gene with multiple splicing (Rbpms), transcript variant X6, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rbpms (19663)
Length:
844
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_378781.2
NBCI Gene record:
Rbpms (19663)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_378781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000123735 CGCTACGACTAGAGTTTGCTA pLKO.1 272 3UTR 100% 3.000 4.200 N Rbpms n/a
2 TRCN0000123736 CTCACATCTAAACAGCCCGTA pLKO.1 163 3UTR 100% 2.160 3.024 N Rbpms n/a
3 TRCN0000123737 CGACTAGAGTTTGCTAAGGCA pLKO.1 277 3UTR 100% 0.750 1.050 N Rbpms n/a
4 TRCN0000164568 CGACTAGAGTTTGCTAAGGCA pLKO.1 277 3UTR 100% 0.750 1.050 N RBPMS n/a
5 TRCN0000123738 AGCTCACAGTACCTGCACTTT pLKO.1 395 3UTR 100% 4.950 3.465 N Rbpms n/a
6 TRCN0000161776 CAACACTGTACCTCAGTTCAT pLKO.1 357 3UTR 100% 4.950 3.465 N RBPMS n/a
7 TRCN0000163579 GCTAAGGCAAACACGAAGATG pLKO.1 289 3UTR 100% 4.950 3.465 N RBPMS n/a
8 TRCN0000164592 CCAAGAACAAACTCGTAGGGA pLKO.1 311 3UTR 100% 0.750 0.525 N RBPMS n/a
9 TRCN0000160934 GTTTGCTAAGGCAAACACGAA pLKO.1 285 3UTR 100% 0.264 0.185 N RBPMS n/a
10 TRCN0000429813 ATCCGCTTCGATCCTGAAATT pLKO_005 244 3UTR 100% 13.200 18.480 N RBPMS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_378781.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02600 pDONR223 100% 60.7% None (many diffs) n/a
2 ccsbBroad304_02600 pLX_304 0% 60.7% V5 (many diffs) n/a
3 TRCN0000472652 AAGGAAGCGCAAATAACGCCACCT pLX_317 57.7% 60.7% V5 (many diffs) n/a
Download CSV