Transcript: Mouse XR_386288.3

PREDICTED: Mus musculus predicted gene 6978 (Gm6978), misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gm6978 (629480)
Length:
850
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_386288.3
NBCI Gene record:
Gm6978 (629480)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_386288.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239505 CCATTGCCCTCTTGAACATTT pLKO_005 143 3UTR 100% 13.200 6.600 Y LOC441722 n/a
2 TRCN0000315163 TGAATAACCGTTGGTTTAATG pLKO_005 398 3UTR 100% 13.200 6.600 Y U2AF1 n/a
3 TRCN0000123549 CCTCTTGAACATTTACCGTAA pLKO.1 150 3UTR 100% 4.050 2.025 Y U2af1 n/a
4 TRCN0000123550 CGACTTGAATAACCGTTGGTT pLKO.1 393 3UTR 100% 3.000 1.500 Y U2af1 n/a
5 TRCN0000332109 CGACTTGAATAACCGTTGGTT pLKO_005 393 3UTR 100% 3.000 1.500 Y U2af1 n/a
6 TRCN0000123553 CCAGTAACTGACTTCAGGGAA pLKO.1 445 3UTR 100% 2.640 1.320 Y U2af1 n/a
7 TRCN0000332108 CCAGTAACTGACTTCAGGGAA pLKO_005 445 3UTR 100% 2.640 1.320 Y U2af1 n/a
8 TRCN0000123552 GCCCTCTTGAACATTTACCGT pLKO.1 148 3UTR 100% 0.750 0.375 Y U2af1 n/a
9 TRCN0000332111 GCCCTCTTGAACATTTACCGT pLKO_005 148 3UTR 100% 0.750 0.375 Y U2af1 n/a
10 TRCN0000001159 GTTGGTTTAATGGACAGCCGA pLKO.1 407 3UTR 100% 0.660 0.330 Y U2AF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_386288.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01731 pDONR223 100% 73.7% None (many diffs) n/a
2 ccsbBroad304_01731 pLX_304 0% 73.7% V5 (many diffs) n/a
3 TRCN0000471281 CGCTGTTGAGCGTCCCGGAGAGTC pLX_317 53.9% 73.7% V5 (many diffs) n/a
4 ccsbBroadEn_07113 pDONR223 100% 50.9% None (many diffs) n/a
5 ccsbBroad304_07113 pLX_304 0% 50.9% V5 (many diffs) n/a
6 TRCN0000473733 CTCTCTAGGATTCGCGCTCTAATC pLX_317 73.3% 50.9% V5 (many diffs) n/a
Download CSV