Transcript: Mouse XR_388449.2

PREDICTED: Mus musculus arachidonate lipoxygenase 3 (Aloxe3), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Aloxe3 (23801)
Length:
2630
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_388449.2
NBCI Gene record:
Aloxe3 (23801)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_388449.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000424387 GGATCGGTTCAGAAGTATAAG pLKO_005 871 3UTR 100% 13.200 18.480 N Aloxe3 n/a
2 TRCN0000067984 GCACGAGAACAACACGCATTT pLKO.1 1935 3UTR 100% 10.800 15.120 N Aloxe3 n/a
3 TRCN0000440329 CCACTTCACCTACACGGATTT pLKO_005 2175 3UTR 100% 10.800 7.560 N Aloxe3 n/a
4 TRCN0000067987 CCAGTACCTGAATGGTGTCAA pLKO.1 1557 3UTR 100% 4.950 3.465 N Aloxe3 n/a
5 TRCN0000067985 GCAAGAACCATCTGTCAGGAT pLKO.1 1081 3UTR 100% 2.640 1.848 N Aloxe3 n/a
6 TRCN0000435986 AGTACCTGAATGGTGTCAATC pLKO_005 1559 3UTR 100% 10.800 7.560 N ALOXE3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_388449.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03879 pDONR223 100% 55.7% None (many diffs) n/a
2 ccsbBroad304_03879 pLX_304 0% 55.7% V5 (many diffs) n/a
Download CSV