Transcript: Human XR_427804.2

PREDICTED: Homo sapiens family with sequence similarity 193 member B (FAM193B), transcript variant X15, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM193B (54540)
Length:
2529
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_427804.2
NBCI Gene record:
FAM193B (54540)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_427804.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271344 TGCCAGCTGAAGGCGTATAAT pLKO_005 2182 3UTR 100% 15.000 21.000 N FAM193B n/a
2 TRCN0000271405 CTCGTTCCTGTCGGCACATAA pLKO_005 603 3UTR 100% 13.200 9.240 N FAM193B n/a
3 TRCN0000062445 GAAGCTCTAAAGCAGGCAAAT pLKO.1 1558 3UTR 100% 10.800 7.560 N FAM193B n/a
4 TRCN0000271406 TGTCACACACATCCTGCAAAT pLKO_005 476 3UTR 100% 10.800 7.560 N FAM193B n/a
5 TRCN0000062446 GCAAAGCAGACTCGTCAGAAA pLKO.1 2055 3UTR 100% 4.950 3.465 N FAM193B n/a
6 TRCN0000062444 GTACTTTAAGAGGTTCTGTTT pLKO.1 2027 3UTR 100% 4.950 3.465 N FAM193B n/a
7 TRCN0000271345 TTGTGGAGATGACTCTCATTC pLKO_005 504 3UTR 100% 10.800 6.480 N FAM193B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_427804.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10509 pDONR223 100% 24.1% None (many diffs) n/a
2 TRCN0000466772 TCCTCTCACTTCAGCGTTTAGCAG pLX_317 29.5% 24.1% V5 (many diffs) n/a
Download CSV