Transcript: Human XR_428088.3

PREDICTED: Homo sapiens CCM2 scaffold protein (CCM2), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCM2 (83605)
Length:
1769
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_428088.3
NBCI Gene record:
CCM2 (83605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_428088.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083234 CCTGGAATTGTCTCGCCATTT pLKO.1 127 3UTR 100% 10.800 8.640 N CCM2 n/a
2 TRCN0000083236 CTATATTGAGAAGGAGGTAAA pLKO.1 279 3UTR 100% 10.800 8.640 N CCM2 n/a
3 TRCN0000426921 CCAGGTCTTCCAGGTTGTTTA pLKO_005 738 3UTR 100% 13.200 9.240 N CCM2 n/a
4 TRCN0000421246 CACACTGTGGTGTTGTCATTG pLKO_005 223 3UTR 100% 10.800 7.560 N CCM2 n/a
5 TRCN0000437822 TCGGACATCAGCAGCGACATT pLKO_005 1314 3UTR 100% 4.950 3.465 N CCM2 n/a
6 TRCN0000083233 GCCCAGGTCCTCTACTGTGAA pLKO.1 1508 3UTR 100% 1.650 1.155 N CCM2 n/a
7 TRCN0000083235 GCATTTCATAGACAATGCAAA pLKO.1 363 3UTR 100% 0.495 0.347 N CCM2 n/a
8 TRCN0000083237 GCTGAGCGACTATATTGAGAA pLKO.1 270 3UTR 100% 4.950 2.970 N CCM2 n/a
9 TRCN0000198459 GCTGAGCGACTATATTGAGAA pLKO.1 270 3UTR 100% 4.950 2.970 N Ccm2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_428088.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04281 pDONR223 100% 69.5% None (many diffs) n/a
2 ccsbBroad304_04281 pLX_304 0% 69.5% V5 (many diffs) n/a
3 TRCN0000469977 AAGTACGCAATTACATCCAACGAA pLX_317 25.2% 69.5% V5 (many diffs) n/a
4 ccsbBroadEn_12745 pDONR223 100% 11.7% None (many diffs) n/a
5 ccsbBroad304_12745 pLX_304 0% 11.7% V5 (many diffs) n/a
6 TRCN0000470550 AGCGCGAAGTGTATTCCTACTCGG pLX_317 100% 11.7% V5 (many diffs) n/a
Download CSV