Transcript: Human XR_428183.3

PREDICTED: Homo sapiens lysine methyltransferase 2C (KMT2C), transcript variant X25, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KMT2C (58508)
Length:
12375
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_428183.3
NBCI Gene record:
KMT2C (58508)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_428183.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358272 CATACTGGGCCAAGCATATAT pLKO_005 7939 3UTR 100% 15.000 21.000 N KMT2C n/a
2 TRCN0000412602 GCGGCAGAAGTTACGTGAAAT pLKO_005 7432 3UTR 100% 13.200 18.480 N KMT2C n/a
3 TRCN0000238935 ATGACCCATTAGCTGATATTT pLKO_005 4518 3UTR 100% 15.000 12.000 N Kmt2c n/a
4 TRCN0000368534 ATGACCCATTAGCTGATATTT pLKO_005 4518 3UTR 100% 15.000 12.000 N KMT2C n/a
5 TRCN0000008743 CCCTGTTAGAATGCCCAGTTT pLKO.1 10258 3UTR 100% 4.950 3.960 N KMT2C n/a
6 TRCN0000358273 TGCAATTACAGATCCTATAAT pLKO_005 9553 3UTR 100% 15.000 10.500 N KMT2C n/a
7 TRCN0000008746 CCAGATACTTTAGTTGATGAA pLKO.1 4214 3UTR 100% 4.950 3.465 N KMT2C n/a
8 TRCN0000008745 CGTCTGAAACAACGTCTGATA pLKO.1 8283 3UTR 100% 4.950 3.465 N KMT2C n/a
9 TRCN0000424482 GTAGTTGAATTGGATACTTTA pLKO_005 8468 3UTR 100% 13.200 7.920 N KMT2C n/a
10 TRCN0000168837 CGCATGACATGCTGCATAATT pLKO.1 2613 3UTR 100% 15.000 7.500 Y BAGE3 n/a
11 TRCN0000371413 CTTCTGAAGTGAAGCATATTT pLKO_005 2127 3UTR 100% 15.000 7.500 Y BAGE3 n/a
12 TRCN0000371417 TATAGCGGTTACTCCATTAAA pLKO_005 1351 3UTR 100% 15.000 7.500 Y BAGE4 n/a
13 TRCN0000168224 CCTGAGGAACAGTTGGTTATA pLKO.1 2366 3UTR 100% 13.200 6.600 Y BAGE2 n/a
14 TRCN0000168341 GCATGGGTAAACCAGCTATTA pLKO.1 2706 3UTR 100% 13.200 6.600 Y BAGE2 n/a
15 TRCN0000371415 GATATAGCGGTTACTCCATTA pLKO_005 1349 3UTR 100% 10.800 5.400 Y BAGE3 n/a
16 TRCN0000168024 CGTGTGACAAAGGGTATCATA pLKO.1 1458 3UTR 100% 5.625 2.813 Y BAGE2 n/a
17 TRCN0000167620 GAGGAACAGTTGGTTATAGAA pLKO.1 2369 3UTR 100% 5.625 2.813 Y BAGE5 n/a
18 TRCN0000168695 GCAAACAATCGGGAGAAGATA pLKO.1 1416 3UTR 100% 5.625 2.813 Y BAGE4 n/a
19 TRCN0000168196 CCTGAAAGATCGAAGGAAGAT pLKO.1 1238 3UTR 100% 4.950 2.475 Y BAGE2 n/a
20 TRCN0000167349 CTTTCAGGATTTCAGTCACAT pLKO.1 1183 3UTR 100% 4.950 2.475 Y BAGE2 n/a
21 TRCN0000168607 GATCGAAGGAAGATGCAAACT pLKO.1 1245 3UTR 100% 4.950 2.475 Y BAGE2 n/a
22 TRCN0000168340 GCAAGATGCTAGTGTGTGATA pLKO.1 1437 3UTR 100% 4.950 2.475 Y BAGE4 n/a
23 TRCN0000168639 GTGTGTGATACGTGTGACAAA pLKO.1 1448 3UTR 100% 4.950 2.475 Y BAGE5 n/a
24 TRCN0000166864 CAGATGTATCATTATCCTTGT pLKO.1 1145 3UTR 100% 4.050 2.025 Y BAGE3 n/a
25 TRCN0000172796 GCTGGAAACATCATGCCAACA pLKO.1 2657 3UTR 100% 4.050 2.025 Y BAGE5 n/a
26 TRCN0000168727 GTTTCATACCAAGGAGGCAAA pLKO.1 2489 3UTR 100% 4.050 2.025 Y BAGE5 n/a
27 TRCN0000172899 GCTCCTGAAAGATCGAAGGAA pLKO.1 1235 3UTR 100% 3.000 1.500 Y BAGE2 n/a
28 TRCN0000173000 CCAGAACACATTGACCAAGCT pLKO.1 1217 3UTR 100% 2.640 1.320 Y BAGE2 n/a
29 TRCN0000168402 GAAAGATCGAAGGAAGATGCA pLKO.1 1241 3UTR 100% 2.640 1.320 Y BAGE3 n/a
30 TRCN0000168767 GCAGTTGTTAGAGGAACCTAA pLKO.1 2236 3UTR 100% 4.950 2.475 Y BAGE4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_428183.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09255 pDONR223 100% 2.3% None (many diffs) n/a
2 ccsbBroad304_09255 pLX_304 0% 2.3% V5 (many diffs) n/a
3 TRCN0000468075 ATACTCGCAATGAAACTCCGACGA pLX_317 100% 2.3% V5 (many diffs) n/a
Download CSV