Transcript: Mouse XR_873456.2

PREDICTED: Mus musculus thyroid hormone receptor interactor 13 (Trip13), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Trip13 (69716)
Length:
2336
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_873456.2
NBCI Gene record:
Trip13 (69716)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_873456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000024991 GAAGATATAAAGTCGAGTGTT pLKO.1 335 3UTR 100% 4.950 6.930 N Trip13 n/a
2 TRCN0000319688 GAAGATATAAAGTCGAGTGTT pLKO_005 335 3UTR 100% 4.950 6.930 N Trip13 n/a
3 TRCN0000024989 CCGAGTAGTCAATGCTGTGTT pLKO.1 1065 3UTR 100% 4.950 3.960 N Trip13 n/a
4 TRCN0000024992 GACACAGAACTAAAGGCTAAA pLKO.1 458 3UTR 100% 10.800 7.560 N Trip13 n/a
5 TRCN0000319689 GACACAGAACTAAAGGCTAAA pLKO_005 458 3UTR 100% 10.800 7.560 N Trip13 n/a
6 TRCN0000024990 CGTACTCTTCTCAGACAAGAA pLKO.1 697 3UTR 100% 4.950 3.465 N Trip13 n/a
7 TRCN0000319690 CGTACTCTTCTCAGACAAGAA pLKO_005 697 3UTR 100% 4.950 3.465 N Trip13 n/a
8 TRCN0000024993 GACAAACAGTTTGAGGAGAAA pLKO.1 1498 3UTR 100% 4.950 3.465 N Trip13 n/a
9 TRCN0000319751 GACAAACAGTTTGAGGAGAAA pLKO_005 1498 3UTR 100% 4.950 3.465 N Trip13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_873456.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02137 pDONR223 100% 48.7% None (many diffs) n/a
2 ccsbBroad304_02137 pLX_304 0% 48.7% V5 (many diffs) n/a
3 TRCN0000474761 TGACTTTTACCGTCATAATCGTCA pLX_317 36.8% 48.7% V5 (many diffs) n/a
Download CSV