Transcript: Mouse XR_875215.1

PREDICTED: Mus musculus adhesion G protein-coupled receptor B1 (Adgrb1), transcript variant X8, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Adgrb1 (107831)
Length:
6124
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_875215.1
NBCI Gene record:
Adgrb1 (107831)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_875215.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000225913 GGTCCGTTATCCTCATCAATT pLKO_005 3833 3UTR 100% 13.200 18.480 N LOC100045900 n/a
2 TRCN0000109530 CCGCCATAGGACGGGCACAGA pLKO.1 5600 3UTR 100% 0.000 0.000 N Adgrb1 n/a
3 TRCN0000109531 CGGTCCGTTATCCTCATCAAT pLKO.1 3832 3UTR 100% 5.625 4.500 N Adgrb1 n/a
4 TRCN0000109533 CGCATGAAGGATTTGAGGGAT pLKO.1 3157 3UTR 100% 2.640 2.112 N Adgrb1 n/a
5 TRCN0000225911 ACAACTGTCCTCAACTCTAAG pLKO_005 3427 3UTR 100% 10.800 7.560 N LOC100045900 n/a
6 TRCN0000225912 CACCCTTGGAGATCGAGTTTG pLKO_005 3491 3UTR 100% 10.800 7.560 N LOC100045900 n/a
7 TRCN0000225914 TGGTTGGCCAGGACATCATTG pLKO_005 5503 3UTR 100% 10.800 7.560 N LOC100045900 n/a
8 TRCN0000109532 CCCAAATACAGCATCAACATT pLKO.1 4875 3UTR 100% 5.625 3.938 N Adgrb1 n/a
9 TRCN0000109534 CGGTATGCAGAACTGGACTTT pLKO.1 5214 3UTR 100% 4.950 3.465 N Adgrb1 n/a
10 TRCN0000008116 GCAAACCAAGTTCTGCAACAT pLKO.1 2247 3UTR 100% 4.950 3.465 N ADGRB1 n/a
11 TRCN0000218626 CCAAATACAGCATCAACATTG pLKO_005 4876 3UTR 100% 10.800 6.480 N LOC100045900 n/a
12 TRCN0000378107 TCGAGTTTGCCCACATGTATA pLKO_005 3503 3UTR 100% 13.200 9.240 N ADGRB1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_875215.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489832 TCATACGTCGTTGTAGGAGTTGAG pLX_317 7.6% 59.1% V5 (many diffs) n/a
2 TRCN0000489318 GCTCGAGGCGATTACGCTCATCTT pLX_317 7.7% 59.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV