Transcript: Mouse XR_878851.1

PREDICTED: Mus musculus membrane-bound transcription factor peptidase, site 1 (Mbtps1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mbtps1 (56453)
Length:
3354
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_878851.1
NBCI Gene record:
Mbtps1 (56453)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_878851.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032814 CGACCCTATTTACCACAGAAT pLKO.1 2106 3UTR 100% 4.950 6.930 N Mbtps1 n/a
2 TRCN0000331602 CGACCCTATTTACCACAGAAT pLKO_005 2106 3UTR 100% 4.950 6.930 N Mbtps1 n/a
3 TRCN0000032817 GCCTATCTACTATGGAGGAAT pLKO.1 2012 3UTR 100% 4.950 3.960 N Mbtps1 n/a
4 TRCN0000302215 GCCTATCTACTATGGAGGAAT pLKO_005 2012 3UTR 100% 4.950 3.960 N Mbtps1 n/a
5 TRCN0000032816 CGGATGAAGAATGACCCTTTA pLKO.1 2433 3UTR 100% 10.800 7.560 N Mbtps1 n/a
6 TRCN0000302143 CGGATGAAGAATGACCCTTTA pLKO_005 2433 3UTR 100% 10.800 7.560 N Mbtps1 n/a
7 TRCN0000013271 CCTGACTTTGAAGGTGGAATT pLKO.1 623 3UTR 100% 0.000 0.000 N MBTPS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_878851.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11298 pDONR223 100% 44% None (many diffs) n/a
2 ccsbBroad304_11298 pLX_304 0% 44% V5 (many diffs) n/a
3 TRCN0000472973 CGGAGCCCGGCTTCAGTTCATCGG pLX_317 27.8% 44% V5 (many diffs) n/a
Download CSV