Transcript: Human XR_922962.1

PREDICTED: Homo sapiens KAT8 regulatory NSL complex subunit 3 (KANSL3), transcript variant X17, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KANSL3 (55683)
Length:
3087
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_922962.1
NBCI Gene record:
KANSL3 (55683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_922962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000168494 GAAGATCAAGGTGTCCCTTAT pLKO.1 2078 3UTR 100% 10.800 15.120 N KANSL3 n/a
2 TRCN0000370823 GTGAACGGCATGTCATCTTTG pLKO_005 454 3UTR 100% 10.800 15.120 N KANSL3 n/a
3 TRCN0000168392 GCTTGTGTCATCCAACACAAA pLKO.1 833 3UTR 100% 0.495 0.396 N KANSL3 n/a
4 TRCN0000266996 AGCATGGTGGACAGATGTATT pLKO_005 1506 3UTR 100% 13.200 9.240 N Kansl3 n/a
5 TRCN0000365610 AGCATGGTGGACAGATGTATT pLKO_005 1506 3UTR 100% 13.200 9.240 N KANSL3 n/a
6 TRCN0000370822 GGCCTGTCATGTGTCAGTAAT pLKO_005 1223 3UTR 100% 13.200 9.240 N KANSL3 n/a
7 TRCN0000365592 TTCCCACACAAACCCATTATC pLKO_005 1173 3UTR 100% 13.200 9.240 N KANSL3 n/a
8 TRCN0000168822 CCCACACAAACCCATTATCTT pLKO.1 1175 3UTR 100% 5.625 3.938 N KANSL3 n/a
9 TRCN0000168754 GAGCTGATGACAATCTCAGAA pLKO.1 1447 3UTR 100% 4.950 3.465 N KANSL3 n/a
10 TRCN0000172781 GATCACTACACTGAGCCCTAT pLKO.1 2649 3UTR 100% 4.050 2.835 N KANSL3 n/a
11 TRCN0000370887 AGGAGAGAAAGAGGATCTTAG pLKO_005 1994 3UTR 100% 10.800 6.480 N KANSL3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_922962.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03629 pDONR223 100% 78.7% None (many diffs) n/a
2 ccsbBroad304_03629 pLX_304 0% 78.7% V5 (many diffs) n/a
3 TRCN0000470202 ACTTGCCGGATACGATAAGGAAAG pLX_317 15.3% 78.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV