Transcript: Human XR_925582.2

PREDICTED: Homo sapiens solute carrier family 12 member 7 (SLC12A7), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC12A7 (10723)
Length:
5470
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_925582.2
NBCI Gene record:
SLC12A7 (10723)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_925582.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000238384 CCCAGTGGTTAGGTTGCATTT pLKO_005 3843 3UTR 100% 10.800 15.120 N SLC12A7 n/a
2 TRCN0000238385 GCCATAGTGACGACGTCTTTC pLKO_005 1444 3UTR 100% 10.800 15.120 N SLC12A7 n/a
3 TRCN0000042969 CGTGGTCTTACGAGATAAGTT pLKO.1 1509 3UTR 100% 5.625 7.875 N SLC12A7 n/a
4 TRCN0000042971 GTCCCTAATGAGCACAGAGAA pLKO.1 2322 3UTR 100% 4.950 6.930 N SLC12A7 n/a
5 TRCN0000238386 GCGGGTCCTACTACATGATAT pLKO_005 620 3UTR 100% 13.200 9.240 N SLC12A7 n/a
6 TRCN0000238388 TCTTCGTGGGCGTCAAGTATG pLKO_005 869 3UTR 100% 10.800 7.560 N SLC12A7 n/a
7 TRCN0000042968 CCTCCCTTTCTATGTGGCATA pLKO.1 4775 3UTR 100% 4.050 2.835 N SLC12A7 n/a
8 TRCN0000042970 GAAGGGAAGAACATGGCACTT pLKO.1 265 3UTR 100% 4.050 2.835 N SLC12A7 n/a
9 TRCN0000238387 TGATCACCATCTACTCCTAAT pLKO_005 3475 3UTR 100% 10.800 6.480 N SLC12A7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_925582.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14053 pDONR223 100% 13.9% None (many diffs) n/a
2 ccsbBroad304_14053 pLX_304 0% 13.9% V5 (many diffs) n/a
3 TRCN0000466206 CTACACTCGTTGTGTCCGATGGTT pLX_317 42.2% 13.9% V5 (many diffs) n/a
Download CSV