Transcript: Human XR_926300.3

PREDICTED: Homo sapiens inflammation and lipid regulator with UBA-like and NBR1-like domains (ILRUN), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ILRUN (64771)
Length:
5602
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_926300.3
NBCI Gene record:
ILRUN (64771)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_926300.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430606 GCAGCAATTGGCGCCTATTAT pLKO_005 331 3UTR 100% 15.000 21.000 N ILRUN n/a
2 TRCN0000419891 TCCGGATACTCAGTTTGTAAA pLKO_005 432 3UTR 100% 13.200 18.480 N ILRUN n/a
3 TRCN0000140195 GAGTTCGACTCGATCAGCAAA pLKO.1 862 3UTR 100% 4.950 6.930 N ILRUN n/a
4 TRCN0000144085 CTTTGTTGAAGATGTCACCAT pLKO.1 390 3UTR 100% 2.640 3.696 N ILRUN n/a
5 TRCN0000414962 AGAACCGACAATCAGATGAAA pLKO_005 815 3UTR 100% 5.625 3.938 N ILRUN n/a
6 TRCN0000426426 AGACCAATTTGGACATGTGAA pLKO_005 522 3UTR 100% 4.950 3.465 N ILRUN n/a
7 TRCN0000145604 CACGCAAACAACTTATCAGTA pLKO.1 988 3UTR 100% 4.950 3.465 N ILRUN n/a
8 TRCN0000425236 GAGTAACGCAGCAGCTGTCAT pLKO_005 719 3UTR 100% 4.950 3.465 N ILRUN n/a
9 TRCN0000139654 CCCAAGAGATTGCAGATGTCA pLKO.1 569 3UTR 100% 3.000 2.100 N ILRUN n/a
10 TRCN0000143122 CAAGACCAGAATAGACTGTCA pLKO.1 937 3UTR 100% 2.640 1.848 N ILRUN n/a
11 TRCN0000139198 CAGGAATGTATCAGGGACAGT pLKO.1 617 3UTR 100% 2.640 1.848 N ILRUN n/a
12 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 5339 3UTR 100% 4.950 2.475 Y CFLAR n/a
13 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 5339 3UTR 100% 4.950 2.475 Y C19orf31 n/a
14 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 4468 3UTR 100% 13.200 6.600 Y LIAS n/a
15 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 5337 3UTR 100% 4.950 2.475 Y ERN2 n/a
16 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 5337 3UTR 100% 4.950 2.475 Y P3H4 n/a
17 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 5337 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_926300.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03964 pDONR223 100% 15.6% None (many diffs) n/a
2 ccsbBroad304_03964 pLX_304 0% 15.6% V5 (many diffs) n/a
3 TRCN0000467794 CTGACCCCTTCAGTACCCGCCGCT pLX_317 43.5% 15.6% V5 (many diffs) n/a
Download CSV