Transcript: Human XR_927552.3

PREDICTED: Homo sapiens ubiquitin protein ligase E3C (UBE3C), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
UBE3C (9690)
Length:
5100
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_927552.3
NBCI Gene record:
UBE3C (9690)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_927552.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003401 CCAGTCATTTATTCGAGGCTA pLKO.1 477 3UTR 100% 2.640 2.112 N UBE3C n/a
2 TRCN0000003402 GCAGATAAGCAAGAAGTTCAA pLKO.1 2355 3UTR 100% 4.950 3.465 N UBE3C n/a
3 TRCN0000342611 GCAGATAAGCAAGAAGTTCAA pLKO_005 2355 3UTR 100% 4.950 3.465 N UBE3C n/a
4 TRCN0000003400 GTCCTATTTCTATCTCCACTT pLKO.1 4161 3UTR 100% 4.050 2.835 N UBE3C n/a
5 TRCN0000342612 GTCCTATTTCTATCTCCACTT pLKO_005 4161 3UTR 100% 4.050 2.835 N UBE3C n/a
6 TRCN0000010783 GTCAGGCTTCTCTACAGTTTA pLKO.1 1648 3UTR 100% 13.200 7.920 N UBE3C n/a
7 TRCN0000352642 GTCAGGCTTCTCTACAGTTTA pLKO_005 1648 3UTR 100% 13.200 7.920 N UBE3C n/a
8 TRCN0000003399 GCCAGACATTACTACTTCCTA pLKO.1 2676 3UTR 100% 3.000 1.800 N UBE3C n/a
9 TRCN0000040493 GCTCTCTGTTTGTCAAGCAAT pLKO.1 695 3UTR 100% 4.950 3.465 N Ube3c n/a
10 TRCN0000301278 GCTCTCTGTTTGTCAAGCAAT pLKO_005 695 3UTR 100% 4.950 3.465 N Ube3c n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_927552.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11405 pDONR223 100% 38% None (many diffs) n/a
2 ccsbBroad304_11405 pLX_304 0% 38% V5 (many diffs) n/a
3 TRCN0000477446 TGTCGGTGAGTGCAAGTAGTTATA pLX_317 22.6% 38% V5 (many diffs) n/a
4 ccsbBroadEn_15674 pDONR223 0% 23.7% None (many diffs) n/a
5 ccsbBroad304_15674 pLX_304 0% 23.7% V5 (many diffs) n/a
6 TRCN0000472548 CTCAGAAGTTACCGATGAATAAAA pLX_317 43.7% 23.7% V5 (many diffs) n/a
Download CSV