Transcript: Human XR_927955.2

PREDICTED: Homo sapiens uncharacterized LOC101928451 (LOC101928451), transcript variant X5, ncRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOC101928451 (101928451)
Length:
1827
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_927955.2
NBCI Gene record:
LOC101928451 (101928451)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_927955.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356114 ACGATCCTCACCGCAACATTC pLKO_005 808 3UTR 100% 10.800 5.400 Y TLK2 n/a
2 TRCN0000195560 CCACTTAATAGTGAGTCTTCC pLKO.1 558 3UTR 100% 4.050 2.025 Y TLK2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_927955.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487715 TATTTCCAATGAACCAGATCAATC pLX_317 11.4% 42.3% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489119 TACCTGTAGTGACCTCCCATAAGG pLX_317 13.2% 42.3% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000488113 TATTTTACTACGACAAAGTGCAGT pLX_317 11.3% 42.3% V5 (many diffs) n/a
4 TRCN0000491778 AGGCAAGCATAGGGACCATCCCTT pLX_317 16.4% 42.3% V5 (many diffs) n/a
5 ccsbBroadEn_11580 pDONR223 100% 41.7% None (many diffs) n/a
6 ccsbBroad304_11580 pLX_304 0% 41.7% V5 (many diffs) n/a
7 TRCN0000478401 TTACCGGTATGCAGATCCGGTTTT pLX_317 11.1% 41.7% V5 (many diffs) n/a
8 ccsbBroadEn_14984 pDONR223 0% 41.7% None (many diffs) n/a
9 ccsbBroad304_14984 pLX_304 0% 41.7% V5 (many diffs) n/a
10 TRCN0000474191 TTCGATGTTAGGTGTGTATCGATA pLX_317 18.7% 41.7% V5 (many diffs) n/a
Download CSV