Transcript: Human XR_933182.3

PREDICTED: Homo sapiens craniofacial development protein 1 (CFDP1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CFDP1 (10428)
Length:
1268
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_933182.3
NBCI Gene record:
CFDP1 (10428)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_933182.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000148111 GTGAAGAAGTAAGGGTAACTA pLKO.1 639 3UTR 100% 5.625 3.938 N CFDP1 n/a
2 TRCN0000275139 GTGAAGAAGTAAGGGTAACTA pLKO_005 639 3UTR 100% 5.625 3.938 N CFDP1 n/a
3 TRCN0000128625 CAAATCCTTCTTCAAGCAGAA pLKO.1 688 3UTR 100% 4.050 2.835 N CFDP1 n/a
4 TRCN0000275089 CAAATCCTTCTTCAAGCAGAA pLKO_005 688 3UTR 100% 4.050 2.835 N CFDP1 n/a
5 TRCN0000149223 GAAGATGAAGTGGATGGTGAA pLKO.1 227 3UTR 100% 4.050 2.835 N CFDP1 n/a
6 TRCN0000146434 CCTCTCATTAGAAGAAGAGGA pLKO.1 322 3UTR 100% 0.264 0.158 N CFDP1 n/a
7 TRCN0000163739 GAAGAAGAGGAAGAGGAGGAA pLKO.1 332 3UTR 100% 2.640 1.320 Y CCDC88B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_933182.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07604 pDONR223 100% 61.8% None (many diffs) n/a
2 ccsbBroad304_07604 pLX_304 0% 61.8% V5 (many diffs) n/a
3 TRCN0000479913 CGTGACAAATGCGGATTCCTGCCG pLX_317 45.2% 61.8% V5 (many diffs) n/a
Download CSV