Transcript: Human XR_934433.1

PREDICTED: Homo sapiens HEAT repeat containing 9 (HEATR9), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
HEATR9 (256957)
Length:
2069
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_934433.1
NBCI Gene record:
HEATR9 (256957)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_934433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000155859 CCCGTACTGCTACTTCAAGAA pLKO.1 315 3UTR 100% 4.950 6.930 N HEATR9 n/a
2 TRCN0000155539 GCTCAAGTTGAAGCCTACGAT pLKO.1 1296 3UTR 100% 3.000 4.200 N HEATR9 n/a
3 TRCN0000150695 GCTAGAGGAACTCACATTTAA pLKO.1 1203 3UTR 100% 15.000 10.500 N HEATR9 n/a
4 TRCN0000151497 CAATGAGCAAGCTGACTATAA pLKO.1 476 3UTR 100% 13.200 9.240 N HEATR9 n/a
5 TRCN0000435321 CCAATGAGCAAGCTGACTATA pLKO_005 475 3UTR 100% 13.200 9.240 N HEATR9 n/a
6 TRCN0000412746 ACCCAGAAGAGTTAACTATTC pLKO_005 1746 3UTR 100% 10.800 7.560 N HEATR9 n/a
7 TRCN0000428610 TACGCATCAGTGACAAGTTTG pLKO_005 632 3UTR 100% 10.800 7.560 N HEATR9 n/a
8 TRCN0000151558 GAATATCCAGACAAGACCAAA pLKO.1 87 3UTR 100% 4.950 3.465 N HEATR9 n/a
9 TRCN0000154520 GCCTACGATGATGAACTTGGT pLKO.1 1308 3UTR 100% 2.640 1.848 N HEATR9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_934433.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09918 pDONR223 100% 81.3% None (many diffs) n/a
2 ccsbBroad304_09918 pLX_304 0% 81.3% V5 (many diffs) n/a
3 TRCN0000470686 TATCTAGGGATAAAATCTACCATT pLX_317 23.2% 81.3% V5 (many diffs) n/a
4 ccsbBroadEn_16136 pDONR223 0% 29.4% None (many diffs) n/a
5 ccsbBroad304_16136 pLX_304 0% 29.4% V5 (many diffs) n/a
6 TRCN0000465860 TTATTTGGGAGCACATGAATTCAA pLX_317 50.5% 29.4% V5 (many diffs) n/a
Download CSV