Transcript: Human XR_940392.3

PREDICTED: Homo sapiens SAC1 like phosphatidylinositide phosphatase (SACM1L), transcript variant X2, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SACM1L (22908)
Length:
3435
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_940392.3
NBCI Gene record:
SACM1L (22908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_940392.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000062790 GCAGATGACGTACTTACCATT pLKO.1 149 3UTR 100% 4.950 6.930 N SACM1L n/a
2 TRCN0000286875 GCAGATGACGTACTTACCATT pLKO_005 149 3UTR 100% 4.950 6.930 N SACM1L n/a
3 TRCN0000062791 CGGTTTGTATGGAATGGTCAT pLKO.1 563 3UTR 100% 4.050 5.670 N SACM1L n/a
4 TRCN0000294341 CATCTGGTGGCAGGTAATTAT pLKO_005 263 3UTR 100% 15.000 10.500 N SACM1L n/a
5 TRCN0000379519 TATTGGGACAGTTAGATTTAT pLKO_005 1880 3UTR 100% 15.000 10.500 N SACM1L n/a
6 TRCN0000294340 ATTGTAGAAGCGGTCACTATT pLKO_005 2094 3UTR 100% 13.200 9.240 N SACM1L n/a
7 TRCN0000062789 CCATAGACTTATTTCTTGGAA pLKO.1 1412 3UTR 100% 3.000 2.100 N SACM1L n/a
8 TRCN0000062792 GCTTTGCCTATTATCATGGTT pLKO.1 1498 3UTR 100% 3.000 2.100 N SACM1L n/a
9 TRCN0000286874 GCTTTGCCTATTATCATGGTT pLKO_005 1498 3UTR 100% 3.000 2.100 N SACM1L n/a
10 TRCN0000062788 CGCTATTATGTAAGAGGAATT pLKO.1 734 3UTR 100% 0.000 0.000 N SACM1L n/a
11 TRCN0000286876 CGCTATTATGTAAGAGGAATT pLKO_005 734 3UTR 100% 0.000 0.000 N SACM1L n/a
12 TRCN0000081326 GCTTGTGATGATGGAGCAGAT pLKO.1 134 3UTR 100% 4.050 2.430 N Sacm1l n/a
13 TRCN0000332364 GCTTGTGATGATGGAGCAGAT pLKO_005 134 3UTR 100% 4.050 2.430 N Sacm1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_940392.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07814 pDONR223 100% 45.3% None (many diffs) n/a
2 ccsbBroad304_07814 pLX_304 0% 45.3% V5 (many diffs) n/a
3 TRCN0000466061 CTACCCCATCTGTCTTCAGGGTTG pLX_317 24.4% 45.3% V5 (many diffs) n/a
Download CSV