Transcript: Human XR_941672.1

PREDICTED: Homo sapiens diaphanous related formin 3 (DIAPH3), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DIAPH3 (81624)
Length:
6529
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_941672.1
NBCI Gene record:
DIAPH3 (81624)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_941672.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000153101 GCTTGTATGCAGCTCATCAAT pLKO.1 1180 3UTR 100% 5.625 7.875 N DIAPH3 n/a
2 TRCN0000151280 CGTGTCAGAATAGCTAAAGAA pLKO.1 3241 3UTR 100% 5.625 4.500 N DIAPH3 n/a
3 TRCN0000154182 CCTTCGGATTTAACCTTAGCT pLKO.1 2738 3UTR 100% 3.000 2.400 N DIAPH3 n/a
4 TRCN0000153579 GTTAAACTTCTCTCTGCGGTA pLKO.1 1027 3UTR 100% 2.160 1.728 N DIAPH3 n/a
5 TRCN0000414550 GCTGATTCGAAATGATTATTT pLKO_005 1497 3UTR 100% 15.000 10.500 N DIAPH3 n/a
6 TRCN0000152148 CCACATTCATGCAAGCAATAA pLKO.1 3179 3UTR 100% 13.200 9.240 N DIAPH3 n/a
7 TRCN0000150903 GCTCAGTGCTATTCTCTTTAA pLKO.1 2559 3UTR 100% 13.200 9.240 N DIAPH3 n/a
8 TRCN0000150559 GTGACAAAGATGTCCAGATTT pLKO.1 3010 3UTR 100% 13.200 9.240 N DIAPH3 n/a
9 TRCN0000422757 TGGCCTGGATATCCAACTTAA pLKO_005 1311 3UTR 100% 13.200 9.240 N DIAPH3 n/a
10 TRCN0000151813 CAACATCAAACCTGACATCAT pLKO.1 2604 3UTR 100% 4.950 3.465 N DIAPH3 n/a
11 TRCN0000150850 GCATGACAAGTTTGTGACAAA pLKO.1 2997 3UTR 100% 4.950 3.465 N DIAPH3 n/a
12 TRCN0000151078 GCATGAGAAGATTGAATTGGT pLKO.1 2096 3UTR 100% 3.000 2.100 N DIAPH3 n/a
13 TRCN0000152084 CCAGATTTGTTATCAGTGCAA pLKO.1 3023 3UTR 100% 2.640 1.848 N DIAPH3 n/a
14 TRCN0000151516 CATCTCCTGATGATTTGGATT pLKO.1 1211 3UTR 100% 4.950 2.970 N DIAPH3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_941672.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04249 pDONR223 100% 38.8% None (many diffs) n/a
2 ccsbBroad304_04249 pLX_304 0% 38.8% V5 (many diffs) n/a
3 TRCN0000491728 CTGAGATAATATTGGGAATCTTCT pLX_317 12.8% 38.8% V5 (many diffs) n/a
Download CSV