Transcript: Human XR_942617.3

PREDICTED: Homo sapiens RNA guanylyltransferase and 5'-phosphatase (RNGTT), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RNGTT (8732)
Length:
4505
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_942617.3
NBCI Gene record:
RNGTT (8732)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_942617.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002587 CGTCTGTGTGAGCGGTTTAAT pLKO.1 512 3UTR 100% 15.000 21.000 N RNGTT n/a
2 TRCN0000284836 CGTCTGTGTGAGCGGTTTAAT pLKO_005 512 3UTR 100% 15.000 21.000 N RNGTT n/a
3 TRCN0000379847 TATCGTAGCCAGCCTGTAAAT pLKO_005 2199 3UTR 100% 13.200 18.480 N RNGTT n/a
4 TRCN0000272807 GGAATCTACAAGGGTGATTAT pLKO_005 677 3UTR 100% 13.200 10.560 N RNGTT n/a
5 TRCN0000284835 GTGGACTTAAACATCTTATTT pLKO_005 2257 3UTR 100% 15.000 10.500 N RNGTT n/a
6 TRCN0000002589 GCAGTGTATAGAACGAGAAAT pLKO.1 1333 3UTR 100% 13.200 9.240 N RNGTT n/a
7 TRCN0000272808 GCAGTGTATAGAACGAGAAAT pLKO_005 1333 3UTR 100% 13.200 9.240 N RNGTT n/a
8 TRCN0000002586 CTGAGAATACTGAGACCTTTA pLKO.1 489 3UTR 100% 10.800 7.560 N RNGTT n/a
9 TRCN0000444560 TGGAATTTCCATTTCGTAAAG pLKO_005 1164 3UTR 100% 10.800 7.560 N Rngtt n/a
10 TRCN0000002590 GCAGAGGCAAAGTGTAGACAT pLKO.1 3085 3UTR 100% 4.950 3.465 N RNGTT n/a
11 TRCN0000002588 GCCAAAGAAGTGAGCCATGAA pLKO.1 1478 3UTR 100% 4.950 3.465 N RNGTT n/a
12 TRCN0000220491 GCCATGAAATGGATGGACTTA pLKO.1 1491 3UTR 100% 4.950 3.465 N Rngtt n/a
13 TRCN0000220493 CCAGGAATCTACAAGGGTGAT pLKO.1 674 3UTR 100% 4.050 2.835 N Rngtt n/a
14 TRCN0000438977 ATGTTGATTGATGGCACAAAT pLKO_005 1094 3UTR 100% 13.200 7.920 N Rngtt n/a
15 TRCN0000272749 CTTCGTATGCATTTATCAAAT pLKO_005 1187 3UTR 100% 13.200 7.920 N RNGTT n/a
16 TRCN0000220492 CCACTGAGAATACTGAGACAT pLKO.1 486 3UTR 100% 4.950 3.465 N Rngtt n/a
17 TRCN0000081181 CCAGACCACCAGGAATCTATA pLKO.1 666 3UTR 100% 13.200 7.920 N LOC436408 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_942617.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07291 pDONR223 100% 39.7% None (many diffs) n/a
2 ccsbBroad304_07291 pLX_304 0% 39.7% V5 (many diffs) n/a
3 TRCN0000481556 CATGTAGGCATCATCTGTCAAGTA pLX_317 15% 39.7% V5 (many diffs) n/a
Download CSV