Transcript: Human XR_944700.1

PREDICTED: Homo sapiens nuclear receptor subfamily 2 group C member 1 (NR2C1), transcript variant X13, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NR2C1 (7181)
Length:
1691
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_944700.1
NBCI Gene record:
NR2C1 (7181)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_944700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244442 GATGAATGTAGCAACTATATT pLKO_005 1409 3UTR 100% 15.000 12.000 N NR2C1 n/a
2 TRCN0000021648 GCCAATGTGGTTACATCATTA pLKO.1 1060 3UTR 100% 13.200 10.560 N NR2C1 n/a
3 TRCN0000021646 CCATTGAAGTATCACGAGAAA pLKO.1 809 3UTR 100% 4.950 3.960 N NR2C1 n/a
4 TRCN0000244444 GCAGGTGTCAACCAGTTATTT pLKO_005 472 3UTR 100% 15.000 10.500 N NR2C1 n/a
5 TRCN0000244441 AGGACCTTCGTAGCCCATTAA pLKO_005 875 3UTR 100% 13.200 9.240 N NR2C1 n/a
6 TRCN0000021645 CGAGGATCAAAGGATTGTATT pLKO.1 691 3UTR 100% 13.200 9.240 N NR2C1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_944700.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01709 pDONR223 100% 66.5% None 1_243del;1207_1208ins166;1479_1691del n/a
2 ccsbBroad304_01709 pLX_304 0% 66.5% V5 1_243del;1207_1208ins166;1479_1691del n/a
3 TRCN0000466565 GTAGGGGTTCACCGAAATCTACAC pLX_317 29.3% 66.5% V5 1_243del;1207_1208ins166;1479_1691del n/a
4 TRCN0000488735 TATACCCAAGGGAGTGTTTATAAA pLX_317 19% 66.5% V5 (not translated due to prior stop codon) 1_243del;1207_1208ins166;1479_1691del n/a
Download CSV