Transcript: Human XR_950864.3

PREDICTED: Homo sapiens nuclear factor of activated T cells 2 interacting protein (NFATC2IP), transcript variant X1, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NFATC2IP (84901)
Length:
2585
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_950864.3
NBCI Gene record:
NFATC2IP (84901)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_950864.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435445 CCTTATCCCAGATGATCTATC pLKO_005 425 3UTR 100% 10.800 15.120 N NFATC2IP n/a
2 TRCN0000073137 CCGGGATAACAGCAACAGTGA pLKO.1 272 3UTR 100% 2.640 3.696 N NFATC2IP n/a
3 TRCN0000432363 ACATTTGCTTGAGGCTTATAC pLKO_005 1461 3UTR 100% 13.200 9.240 N NFATC2IP n/a
4 TRCN0000416062 AGACCCTCATGTCCCACTATG pLKO_005 867 3UTR 100% 10.800 7.560 N NFATC2IP n/a
5 TRCN0000073134 CTGAGGACTAAGGATAAAGAA pLKO.1 555 3UTR 100% 5.625 3.938 N NFATC2IP n/a
6 TRCN0000073136 GAGAGACAGAGCTATCACCTA pLKO.1 678 3UTR 100% 2.640 1.584 N NFATC2IP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_950864.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12877 pDONR223 100% 15.9% None (many diffs) n/a
2 ccsbBroad304_12877 pLX_304 0% 15.9% V5 (many diffs) n/a
3 TRCN0000471136 ATAAATCCTGATCGTGATAGCTTA pLX_317 100% 15.9% V5 (many diffs) n/a
4 ccsbBroadEn_12878 pDONR223 100% 14.7% None 1_628del;1010_2585del n/a
5 ccsbBroad304_12878 pLX_304 0% 14.7% V5 1_628del;1010_2585del n/a
6 TRCN0000479159 AGCCCGTGTTGGATTTCAGTAACT pLX_317 100% 14.7% V5 1_628del;1010_2585del n/a
Download CSV