Construct: ORF TRCN0000465566
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007296.1_s317c1
- Derived from:
- ccsbBroadEn_06379
- DNA Barcode:
- TATGGTTATTATAGCAGACTCGAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HLA-G (3135)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000465566
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3135 | HLA-G | major histocompatibility co... | NM_002127.5 | 99.1% | 99.1% | (many diffs) |
| 2 | human | 3135 | HLA-G | major histocompatibility co... | XM_024446420.1 | 99.1% | 99.1% | (many diffs) |
| 3 | human | 3135 | HLA-G | major histocompatibility co... | NM_001363567.1 | 97.6% | 97.6% | (many diffs) |
| 4 | human | 3134 | HLA-F | major histocompatibility co... | XM_011514564.1 | 83.5% | 75.4% | (many diffs) |
| 5 | human | 3105 | HLA-A | major histocompatibility co... | NM_002116.8 | 83.1% | 75.8% | (many diffs) |
| 6 | human | 3134 | HLA-F | major histocompatibility co... | NM_018950.2 | 82.8% | 75% | (many diffs) |
| 7 | human | 3105 | HLA-A | major histocompatibility co... | NM_001242758.1 | 82.5% | 74.7% | (many diffs) |
| 8 | human | 3106 | HLA-B | major histocompatibility co... | NM_005514.8 | 81.8% | 74.5% | (many diffs) |
| 9 | human | 3107 | HLA-C | major histocompatibility co... | NM_001243042.1 | 81.3% | 73.4% | (many diffs) |
| 10 | human | 3107 | HLA-C | major histocompatibility co... | NM_002117.6 | 81.2% | 73.2% | (many diffs) |
| 11 | human | 3133 | HLA-E | major histocompatibility co... | NM_005516.6 | 80.6% | 70.3% | (many diffs) |
| 12 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010809.2 | 80.3% | 70.1% | (many diffs) |
| 13 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010813.1 | 74% | 67% | (many diffs) |
| 14 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010817.1 | 71.9% | 71.5% | (many diffs) |
| 15 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010818.1 | 71.9% | 71.5% | (many diffs) |
| 16 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010807.1 | 71.4% | 57.9% | (many diffs) |
| 17 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010808.1 | 71.4% | 57.9% | (many diffs) |
| 18 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010812.1 | 68.4% | 61.9% | (many diffs) |
| 19 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010811.1 | 66.5% | 60.1% | (many diffs) |
| 20 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010810.1 | 66.1% | 59.8% | (many diffs) |
| 21 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098479.2 | 65.1% | 58.8% | (many diffs) |
| 22 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098478.2 | 59.2% | 52.1% | (many diffs) |
| 23 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010815.1 | 54.4% | 50.1% | (many diffs) |
| 24 | human | 3136 | HLA-H | major histocompatibility co... | NR_001434.4 | 52.8% | (many diffs) | |
| 25 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010814.1 | 42.7% | 39.3% | (many diffs) |
| 26 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743373.1 | 27.1% | (many diffs) | |
| 27 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743374.1 | 26.1% | (many diffs) | |
| 28 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743376.1 | 25.9% | (many diffs) | |
| 29 | human | 3139 | HLA-L | major histocompatibility co... | NR_027822.1 | 15.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1080
- ORF length:
- 1014
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggt ggtcatggca ccccgaaccc tcttcctgct actctcgggg gccctgaccc 121 tgaccgagac ctgggcgggc tcccactcca tgaggtattt cagcgccgcc gtgtcccggc 181 ccagccgcgg ggagccccgc ttcatcgcca tgggctacgt ggacgacacg cagttcgtgc 241 ggttcgacag cgactcggcg tgtccgagga tggagccgcg ggcgccgtgg gtggagcggg 301 aggggccaga gtattgggaa gaggagacac ggaacaccaa ggcccacgca cagactgaca 361 gaatgaacct gcagaccctg cgcggctact acaaccagag cgaggccagt tctcataccc 421 tccagtggat gattggctgc gacctggggt ccgacggacg cctcctccgc gggtatgaac 481 agtatgccta cgatggcaag gattacctcg ccctgaacga ggacctgcgc tcctggaccg 541 cagcggacac tgcggctcag atctccaagc gcaagtgtga ggcggccaat gtggctgaac 601 aaaggagagc ctacctggag ggcacgtgcg tggagtggct ccacagatac ctggagaacg 661 ggaaggagat gctgcagcgc gcggaccccc ccaagacaca cgtgacccac caccctgtct 721 ttgactatga ggccacccTG AGGTGCTGGG CCCTGGGCTT CTACCCTGCG GAGATCATAC 781 TGACCTGGCA GCGGGATGGG GAGGACCAGA CCCAGGACGT GGAGCTCGTG GAGACCAAGC 841 CTGCAGGGGA TGGAACCTTC CAGAAGTGGG CAGCTGTGGT GGTGCCTTCT GGAGAGGAGC 901 AGAGATACAC GTGCCATGTG CAGCATGAGG GGCTGCCGGA GCCCCTCATG CTGAGATGGA 961 AGCAGTCTTC CCTGCCCACC ATCCCCATCA TGGGTATCGT TGCTGGTCTG GTTGTCCTTG 1021 CAGCTGTAGT CACTGGAGCT GCGGTCGCTG CTGTGCTGTG GAGGAAGAAG AGCTCAGATT 1081 GCCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 1141 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTTGA AAGTATTTCG ATTTCTTGGC 1201 TTTATATATC TTGTGGAAAG GACGATATGG TTATTATAGC AGACTCGACA CGCGTTAAGT 1261 Cgacaatcaa cctctggatt acaaaatttg tgaaagatt