Construct: ORF TRCN0000466306
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018886.2_s317c1
- Derived from:
- ccsbBroadEn_15154
- DNA Barcode:
- CTAATCTCCCGAAAGCCTCATTGA
- Epitope Tag:
- V5 (not translated due to prior stop codon)
- Notes:
- Early stop codon detected
Originally Annotated References:
- Gene:
- PIP4K2C (79837)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466306
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 79837 | PIP4K2C | phosphatidylinositol-5-phos... | NM_001146258.2 | 98.4% | 60.6% | (many diffs) |
| 2 | human | 79837 | PIP4K2C | phosphatidylinositol-5-phos... | NM_024779.5 | 98.4% | 60.6% | (many diffs) |
| 3 | human | 79837 | PIP4K2C | phosphatidylinositol-5-phos... | XM_005269152.3 | 95.4% | 57.5% | (many diffs) |
| 4 | human | 79837 | PIP4K2C | phosphatidylinositol-5-phos... | NM_001146259.2 | 94.2% | 56.3% | (many diffs) |
| 5 | human | 79837 | PIP4K2C | phosphatidylinositol-5-phos... | NM_001146260.2 | 87.5% | 50.4% | (many diffs) |
| 6 | human | 79837 | PIP4K2C | phosphatidylinositol-5-phos... | XM_017019973.2 | 58.6% | 21.3% | (many diffs) |
| 7 | human | 79837 | PIP4K2C | phosphatidylinositol-5-phos... | XM_011538747.2 | 56.5% | 83.8% | (many diffs) |
| 8 | mouse | 117150 | Pip4k2c | phosphatidylinositol-5-phos... | NM_054097.3 | 88.7% | 58% | (many diffs) |
| 9 | mouse | 117150 | Pip4k2c | phosphatidylinositol-5-phos... | XM_017313768.1 | 88.7% | 58% | (many diffs) |
| 10 | mouse | 117150 | Pip4k2c | phosphatidylinositol-5-phos... | XM_011243289.2 | 81.1% | 57.3% | (many diffs) |
| 11 | mouse | 117150 | Pip4k2c | phosphatidylinositol-5-phos... | XM_006513120.2 | 78% | 42.4% | (many diffs) |
| 12 | mouse | 117150 | Pip4k2c | phosphatidylinositol-5-phos... | XM_006513121.3 | 78% | 42.4% | (many diffs) |
| 13 | mouse | 117150 | Pip4k2c | phosphatidylinositol-5-phos... | XM_011243288.2 | 71.7% | 41.9% | (many diffs) |
| 14 | mouse | 117150 | Pip4k2c | phosphatidylinositol-5-phos... | XR_871695.2 | 34.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 888
- ORF length:
- 819
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggcgtcctcc tcggtcccac cagccacggt atcggcggcg acagcaggcc 121 ccggcccagg tttcggcttc gcctccaaga ccaagaagaa gcatttcgtg cagcagaagg 181 tgaaggtgtt ccgggcggcc gacccgctgg tgggtgtgtt cctgtggggc gtagcccact 241 cgatcaatga gctcagccag gtgcctcccc cggtgatgct gctgccagat gactttaagg 301 ccagctccaa gatcaaggtc aacaatcacc ttttccacag ggaaaatctg cccagtcatt 361 tcaagttcaa ggagtattgt ccccaggtct tcaggaacct ccgtgatcga tttggcattg 421 atgaccaaga ttacttggtg tcccttaccc gaaacccccc cagcgaaagt gaaggcagtg 481 atggtcgctt ccttatctcc tacgatcgga ctctggtcat caaagaagta tccagtgagn 541 acattgntga catncatagc aacntnncca actatcacca gtacattgtg aagtgccatg 601 gcaacacgcn tntgccccag ttcntgggga tgtaccgagt cagtgtggac aacgaagaca 661 gctacatgct tgtgatgcgc aatatgttta gccaccgtct tcctgtgcac aggaagtatg 721 acctcaaggg ttccctagtg tcccgggaag ccagcgataa ggaaaaggtt aaagaattgc 781 ccacccttaa ngatatggac tttctcaaca agaaccagaa agtatatatt ggtgannngn 841 agaagaaaat atttctggag aagctgaaga agnngatgtg gagtttctag tgcagctgaa 901 gatcatggac tacagccttc tgctaggcat ccacgacatc attcggggct ctgaaccaga 961 ggaggaagcg cccgtgcggg aggatgagtc agaggtggat ggggactgca gcctgactgg 1021 acctccTGCT CTGGTGGGCT CCTATGGCAC CTCCCCAGAG GGTATCGGAG GCTACATCCA 1081 TTCCCATCGG CCCCTGGGCC CAGGAGAGTT TGAGTCCTTC ATTGATGTCT ATGCCATCCG 1141 GAGTGCTGAA GGAGCCCCCC AGAAGGAGGT CTACTTCATG GGCCTCATTG ATATCCTTAC 1201 ACAGTATGAT GCCAAGAAGA AAGCAGCTCA TGCAGCCAAA ACTGTCAAGC ATGGGGCTGG 1261 GGCAGAGATC TCTACTGTCC ATCCGGAGCA GTATGCTAAG CGATTCCTGG ATTTTATTAC 1321 CAACATCTTT GCCTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA AGCCTATCCC 1381 TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC TTGAAAGTAT 1441 TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAC TAATCTCCCG AAAGCCTCAT 1501 TGAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag att