Construct: ORF TRCN0000466488
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010205.1_s317c1
- Derived from:
- ccsbBroadEn_01703
- DNA Barcode:
- ACAATCCGGTTACCCTTTTAGTAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TPM3 (7170)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466488
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7170 | TPM3 | tropomyosin 3 | NM_152263.4 | 100% | 100% | |
| 2 | human | 7170 | TPM3 | tropomyosin 3 | NM_001364682.1 | 95.7% | 94.7% | (many diffs) |
| 3 | human | 7170 | TPM3 | tropomyosin 3 | NM_001364681.2 | 93.2% | 93.3% | (many diffs) |
| 4 | human | 7170 | TPM3 | tropomyosin 3 | NM_001364679.2 | 92.6% | 92.9% | (many diffs) |
| 5 | human | 7170 | TPM3 | tropomyosin 3 | NM_001364680.2 | 88.5% | 87.7% | (many diffs) |
| 6 | human | 7168 | TPM1 | tropomyosin 1 | NM_001018005.2 | 80% | 90.8% | (many diffs) |
| 7 | human | 7168 | TPM1 | tropomyosin 1 | NM_001365779.1 | 79.9% | 90.5% | (many diffs) |
| 8 | human | 7170 | TPM3 | tropomyosin 3 | NM_001349679.2 | 79.7% | 74.9% | (many diffs) |
| 9 | human | 7169 | TPM2 | tropomyosin 2 | NM_003289.3 | 79.6% | 85.9% | (many diffs) |
| 10 | human | 7169 | TPM2 | tropomyosin 2 | XM_017015091.2 | 79.6% | 85.9% | (many diffs) |
| 11 | human | 7170 | TPM3 | tropomyosin 3 | NM_001278189.2 | 75.7% | 69.7% | (many diffs) |
| 12 | human | 7170 | TPM3 | tropomyosin 3 | NM_001364683.1 | 75.7% | 69.7% | (many diffs) |
| 13 | human | 7170 | TPM3 | tropomyosin 3 | NM_001043353.2 | 73.7% | 68.3% | (many diffs) |
| 14 | human | 7170 | TPM3 | tropomyosin 3 | NM_001043351.2 | 73.2% | 68% | (many diffs) |
| 15 | human | 7170 | TPM3 | tropomyosin 3 | NM_001043352.2 | 69.8% | 63.2% | (many diffs) |
| 16 | human | 7170 | TPM3 | tropomyosin 3 | NM_153649.4 | 69.3% | 62.8% | (many diffs) |
| 17 | human | 7170 | TPM3 | tropomyosin 3 | NM_001278190.1 | 62.9% | 55.6% | (many diffs) |
| 18 | human | 7170 | TPM3 | tropomyosin 3 | NM_001278188.2 | 51.1% | 45.9% | (many diffs) |
| 19 | human | 7170 | TPM3 | tropomyosin 3 | NM_001278191.2 | 49.5% | 48.4% | (many diffs) |
| 20 | human | 7170 | TPM3 | tropomyosin 3 | NR_103461.2 | 20.6% | (many diffs) | |
| 21 | mouse | 59069 | Tpm3 | tropomyosin 3, gamma | NM_001293748.1 | 93.8% | 98.9% | (many diffs) |
| 22 | mouse | 59069 | Tpm3 | tropomyosin 3, gamma | NM_022314.3 | 82.7% | 87% | (many diffs) |
| 23 | mouse | 22003 | Tpm1 | tropomyosin 1, alpha | NM_001164248.1 | 80.5% | 91.2% | (many diffs) |
| 24 | mouse | 22003 | Tpm1 | tropomyosin 1, alpha | NM_001164251.1 | 78% | 86.3% | (many diffs) |
| 25 | mouse | 59069 | Tpm3 | tropomyosin 3, gamma | XM_017319678.1 | 76.5% | 74.5% | (many diffs) |
| 26 | mouse | 59069 | Tpm3 | tropomyosin 3, gamma | XM_006501838.1 | 76.4% | 74.2% | (many diffs) |
| 27 | mouse | 59069 | Tpm3 | tropomyosin 3, gamma | XM_006501836.2 | 75% | 73% | (many diffs) |
| 28 | mouse | 59069 | Tpm3 | tropomyosin 3, gamma | NM_001271764.1 | 72.4% | 69.4% | (many diffs) |
| 29 | mouse | 59069 | Tpm3 | tropomyosin 3, gamma | XM_017319677.1 | 72.4% | 69.4% | (many diffs) |
| 30 | mouse | 59069 | Tpm3 | tropomyosin 3, gamma | XM_006501835.2 | 70.9% | 68% | (many diffs) |
| 31 | mouse | 59069 | Tpm3 | tropomyosin 3, gamma | NM_001293749.1 | 70.6% | 68% | (many diffs) |
| 32 | mouse | 59069 | Tpm3 | tropomyosin 3, gamma | NM_001253740.1 | 70.3% | 68% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 921
- ORF length:
- 855
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgat ggaggccatc aagaaaaaga tgcagatgct gaagttagac aaggagaatg 121 ctctggatcg ggcagagcaa gctgaagctg agcagaagca ggcagaagaa agaagtaaac 181 agctggagga tgagctggca gccatgcaga agaagctgaa agggacagag gatgagctgg 241 acaagtattc tgaagctttg aaggatgccc aggagaagct ggaactggca gagaagaagg 301 ctgctgatgc tgaggctgag gtggcctcct tgaaccgtag gatccagctg gttgaagaag 361 agctggaccg tgctcaggag cgcctggcca ctgccctgca aaagctggaa gaagctgaaa 421 aagctgctga tgagagtgag agaggtatga aggttattga aaaccgggcc ttaaaagatg 481 aagaaaagat ggaactccag gaaatccaac tcaaagaagc taagcacatt gcagaagagg 541 cagataggaa gtatgaagag gtggctcgta agttggtgat cattgaagga gacttggaac 601 gcacagagga acgagctgag ctggcagagt ctaagtgttc TGAGCTGGAG GAGGAGCTGA 661 AGAATGTCAC CAACAACCTC AAGTCTCTTG AGGCTCAGGC GGAGAAGTAC TCTCAAAAAG 721 AAGATAAATA TGAGGAAGAA ATCAAGATTC TTACTGATAA ACTCAAGGAG GCAGAGACCC 781 GTGCTGAGTT TGCTGAGAGA TCGGTAGCCA AGCTGGAAAA GACAATTGAT GACCTGGAAG 841 ATGAGCTCTA TGCCCAGAAA CTGAAGTACA AGGCCATTAG CGAGGAGCTG GACCACGCCC 901 TCAATGACAT GACCTCTATA TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 961 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1021 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAACAA TCCGGTTACC 1081 CTTTTAGTAG ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt