Construct: ORF TRCN0000466537
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004032.1_s317c1
- Derived from:
- ccsbBroadEn_10874
- DNA Barcode:
- CCTTGTCTCTTTAGTTCCGGAATC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HLA-B (3106)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466537
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3106 | HLA-B | major histocompatibility co... | NM_005514.8 | 97.1% | 94.4% | (many diffs) |
| 2 | human | 3107 | HLA-C | major histocompatibility co... | NM_001243042.1 | 91.8% | 85.7% | (many diffs) |
| 3 | human | 3107 | HLA-C | major histocompatibility co... | NM_002117.6 | 91.6% | 85.5% | (many diffs) |
| 4 | human | 3105 | HLA-A | major histocompatibility co... | NM_002116.8 | 89.8% | 84.6% | (many diffs) |
| 5 | human | 3105 | HLA-A | major histocompatibility co... | NM_001242758.1 | 89.7% | 83% | (many diffs) |
| 6 | human | 3133 | HLA-E | major histocompatibility co... | NM_005516.6 | 84.8% | 75.2% | (many diffs) |
| 7 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010809.2 | 83.2% | 73.7% | (many diffs) |
| 8 | human | 3134 | HLA-F | major histocompatibility co... | NM_018950.2 | 82.5% | 75.6% | (many diffs) |
| 9 | human | 3135 | HLA-G | major histocompatibility co... | NM_002127.5 | 82.3% | 74.5% | (many diffs) |
| 10 | human | 3135 | HLA-G | major histocompatibility co... | XM_024446420.1 | 82.3% | 74.5% | (many diffs) |
| 11 | human | 3134 | HLA-F | major histocompatibility co... | XM_011514564.1 | 81.2% | 74.3% | (many diffs) |
| 12 | human | 3135 | HLA-G | major histocompatibility co... | NM_001363567.1 | 81.2% | 73.5% | (many diffs) |
| 13 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010813.1 | 79.1% | 70.4% | (many diffs) |
| 14 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010807.1 | 76.3% | 62.2% | (many diffs) |
| 15 | human | 3133 | HLA-E | major histocompatibility co... | XM_017010808.1 | 76.3% | 62.2% | (many diffs) |
| 16 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010812.1 | 73.2% | 65% | (many diffs) |
| 17 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010811.1 | 70.8% | 60.5% | (many diffs) |
| 18 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010810.1 | 70.7% | 62.8% | (many diffs) |
| 19 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098479.2 | 69.6% | 61.8% | (many diffs) |
| 20 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010817.1 | 59.8% | 53.8% | (many diffs) |
| 21 | human | 3135 | HLA-G | major histocompatibility co... | XM_017010818.1 | 59.8% | 53.8% | (many diffs) |
| 22 | human | 3134 | HLA-F | major histocompatibility co... | NM_001098478.2 | 59.8% | 52.2% | (many diffs) |
| 23 | human | 3136 | HLA-H | major histocompatibility co... | NR_001434.4 | 58.2% | (many diffs) | |
| 24 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010815.1 | 55% | 51.6% | (many diffs) |
| 25 | human | 3134 | HLA-F | major histocompatibility co... | XM_017010814.1 | 47.2% | 42.3% | (many diffs) |
| 26 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743373.1 | 29% | (many diffs) | |
| 27 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743374.1 | 27.9% | (many diffs) | |
| 28 | human | 3134 | HLA-F | major histocompatibility co... | XR_001743376.1 | 27.5% | (many diffs) | |
| 29 | human | 3139 | HLA-L | major histocompatibility co... | NR_027822.1 | 16.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1152
- ORF length:
- 1086
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgcg ggtcacggcg ccccgaaccg tcctcctgct gctctcggga gccctggccc 121 tgaccgagac ctgggccggc tcccactcca tgaggtattt ctacaccgcc atgtcccggc 181 ccggccgcgg ggagccccgc ttcatctcag tgggctacgt ggacgacacg cagttcgtga 241 ggttcgacag cgacgccgcg agtccgagag aggagccgcg ggcgccgtgg atagagcagg 301 aggggccgga gtattgggac cggaacacac agatctgcaa gaccaacaca cagacttacc 361 gagagagcct gcggaacctg cgcggctact acaaccagag cgaggccggg tctcacaccc 421 tccagaggat gtacggctgc gacgtggggc cggacgggcg cctcctccgc gggcatgacc 481 agtacgccta cgacggcaag gattacatcg ccctgaacga ggacctgagc tcctggaccg 541 cggcggacac ggcggctcag atcacccagc gcaagtggga ggcggcccgt gaggcggagc 601 agctgagagc ctacctggag ggcctgtgcg tggagtggct ccgcagatac ctggagaacg 661 ggaaggagac gctgcagcgc gcggaccccc caaagacaca tgtgacccac caccccatct 721 ctgaccatga ggccaccctg aggtgctggg ccctgggctt ctaccctgcg gagatcacac 781 tgacctggca gcgggatggc gaggaccaaa ctcaggacac cgagcttgtg gagaccagac 841 cagcaggaga tagaaccttc cagaagtggg cagctgtggt ggtgccTTCT GGAGAAGAGC 901 AGAGATACAC ATGCCATGTA CAGCATGAGG GGCTGCCGAA GCCCCTCACC CTGAGATGGG 961 AGCCATCTTC CCAGTCCACC ATCCCCATCG TGGGCATTGT TGCTGGCCTG GCTGTCCTAG 1021 CAGTTGTGGT CATCGGAGCT GTGGTCGCTA CTGTGATGTG TAGGAGGAAG AGCTCAGGTG 1081 GAAAAGGAGG GAGCTACTCT CAGGCTGCGT CCAGCGACAG TGCCCAGGGC TCTGATGTGT 1141 CTCTCACAGC TTGCCCAACT TTCTTGTACA AAGTGGTTGA TATCGGTAAG CCTATCCCTA 1201 ACCCTCTCCT CGGTCTCGAT TCTACGTAGT AATGAACTAG TCCGTAACTT GAAAGTATTT 1261 CGATTTCTTG GCTTTATATA TCTTGTGGAA AGGACGACCT TGTCTCTTTA GTTCCGGAAT 1321 CACGCGTTAA GTCgacaatc aacctctgga ttacaaaatt tgtgaaagat t