Construct: ORF TRCN0000466603
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013048.2_s317c1
- Derived from:
- ccsbBroadEn_07233
- DNA Barcode:
- ATCACCACTCATATCAAGTCGACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PIP5K1A (8394)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000466603
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001135637.2 | 99.9% | 100% | 930C>T |
| 2 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_003557.3 | 91% | 91% | 930C>T;1325_1471del |
| 3 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001330689.2 | 90.8% | 90.9% | 83_85delCAG;933C>T;1328_1474del |
| 4 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245528.5 | 89.2% | 89.2% | 83_115del;963C>T;1358_1504del |
| 5 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245527.4 | 89% | 89.1% | 117_152del;966C>T;1361_1507del |
| 6 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001135638.2 | 88.9% | 88.9% | (many diffs) |
| 7 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711564.4 | 88.9% | 88.9% | 84_122del;969C>T;1364_1510del |
| 8 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245525.5 | 87.3% | 87.4% | (many diffs) |
| 9 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711563.4 | 87% | 87.1% | (many diffs) |
| 10 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_017002440.1 | 86.5% | 88.7% | 930C>T;1324_1325ins130;1371_1452del |
| 11 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_017002439.1 | 86.3% | 88.5% | (many diffs) |
| 12 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510046.3 | 85.9% | 86% | (many diffs) |
| 13 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245532.4 | 85.8% | 85.8% | (many diffs) |
| 14 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | NM_001135636.2 | 85.7% | 85.6% | (many diffs) |
| 15 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_024450130.1 | 84.7% | 84% | (many diffs) |
| 16 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510043.3 | 84.6% | 84.5% | (many diffs) |
| 17 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_024450131.1 | 84.6% | 84.6% | 0_1ins105;825C>T;1220_1366del |
| 18 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711567.4 | 84.4% | 82.8% | (many diffs) |
| 19 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510048.3 | 84.4% | 82.8% | (many diffs) |
| 20 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510049.3 | 84.4% | 82.8% | (many diffs) |
| 21 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_017002441.2 | 84.4% | 82.8% | (many diffs) |
| 22 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_011510045.3 | 84.1% | 84.2% | (many diffs) |
| 23 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_005245530.5 | 84% | 84% | (many diffs) |
| 24 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_024450129.1 | 83% | 82.3% | (many diffs) |
| 25 | human | 8394 | PIP5K1A | phosphatidylinositol-4-phos... | XM_006711568.4 | 82.9% | 82.7% | (many diffs) |
| 26 | human | 266971 | PIPSL | PIP5K1A and PSMD4 like (pse... | NR_002319.2 | 37.5% | (many diffs) | |
| 27 | human | 206426 | PIP5K1P1 | phosphatidylinositol-4-phos... | NR_027712.1 | 33.1% | (many diffs) | |
| 28 | mouse | 18720 | Pip5k1a | phosphatidylinositol-4-phos... | XM_017319485.1 | 86.7% | 91.2% | (many diffs) |
| 29 | mouse | 18720 | Pip5k1a | phosphatidylinositol-4-phos... | NM_001293707.1 | 79.2% | 83.3% | (many diffs) |
| 30 | mouse | 18720 | Pip5k1a | phosphatidylinositol-4-phos... | NM_008847.3 | 79.2% | 83.3% | (many diffs) |
| 31 | mouse | 18720 | Pip5k1a | phosphatidylinositol-4-phos... | XR_375499.2 | 33.7% | (many diffs) | |
| 32 | mouse | 18720 | Pip5k1a | phosphatidylinositol-4-phos... | XR_375498.2 | 33.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1566
- ORF length:
- 1500
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gtcggcctcc tccgggccgt cgtcttcggt cggtttttca tcctttgatc 121 ccgcggtccc ttcctgtacc ttgtcctcag catctggaat caagagaccc atggcatctg 181 aggtgcctta tgcctctggc atgcccatca agaaaatagg ccatagaagt gttgattcct 241 caggagagac aacatataaa aagacaacct catcagcctt gaaaggtgcc atccagttag 301 gcattaccca cactgtgggg agcctgagta ccaaaccaga gcgtgatgtc ctcatgcaag 361 atttctacgt ggttgagagt atcttctttc ccagtgaagg gagcaacctg acccctgctc 421 atcactacaa tgactttcgt ttcaagacct atgcacctgt tgccttccgc tacttccggg 481 agctatttgg tatccggccc gatgattact tgtattccct ctgcagtgag ccgctgattg 541 aactctgtag ctctggagct agtggttccc tattctatgt gtccagcgac gatgagttca 601 ttattaagac agtccaacat aaagaggcgg aatttctgca gaagctgctt ccaggatact 661 acatgaacct caaccagaac cctcggactt tgctgcctaa attctatgga ctgtactgtg 721 tgcaggcagg tggcaagaac attcggattg tggtgatgaa caatctttta ccaagatcgg 781 taaaaatgca tatcaaatat gacctcaaag gctcaaccta caaacggcgg gcttcccaga 841 aagagcgaga gaagcctctt cccacattta aagacctaga cttcttacaa gacatccctg 901 atggtctttt tttggatgct gacatgtaca acgctctctg taagaccctg cagcgtgact 961 gtttggtgct gcagagcttc aagataatgg attatagcct cttgatgtca atccataata 1021 tagatcatgc acaacgagag cccttaagca gtgaaacaca gtactcagtt gatactcgaa 1081 gaccggcccc ccaaaaggct ctgtattcca cagccatgga atccatccag ggagaggctc 1141 gacggggtgg taccatggag actgatgacc atatgggtgg catccctgcc cggaatagta 1201 aagggGAAAG GCTTCTGCTT TATATTGGCA TCATTGACAT TCTACAGTCT TACAGGTTTG 1261 TTAAGAAGTT GGAGCACTCT TGGAAAGCCC TGGTACATGA CGGAGACACT GTCTCAGTGC 1321 ATCGCCCAGG CTTCTACGCT GAACGGTTCC AGCGCTTCAT GTGCAACACA GTATTTAAGA 1381 AGATTCCCTG CGTTCACCTT GGTCGTCCTG ATGTTTTACC TCAGACTCCA CCTTTGGAGG 1441 AAATCAGTGA GGGCTCGCCT ATTCCTGACC CCAGTTTCTC ACCTCTAGTT GGAGAGACTT 1501 TGCAAATGCT AACTACAAGT ACAACCTTGG AAAAGCTTGA AGTTGCAGAG TCAGAGTTCA 1561 CCCATTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1621 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1681 CTTGGCTTTA TATATCTTGT GGAAAGGACG AATCACCACT CATATCAAGT CGACAACGCG 1741 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt