Transcript: Mouse NM_008847.3

Mus musculus phosphatidylinositol-4-phosphate 5-kinase, type 1 alpha (Pip5k1a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Pip5k1a (18720)
Length:
3673
CDS:
480..2120

Additional Resources:

NCBI RefSeq record:
NM_008847.3
NBCI Gene record:
Pip5k1a (18720)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_008847.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271152 GATATCCCTGACGGCCTATTT pLKO_005 1299 CDS 100% 13.200 18.480 N Pip5k1a n/a
2 TRCN0000271151 TCGTACTTTGCTGCCCAAATT pLKO_005 1091 CDS 100% 13.200 18.480 N Pip5k1a n/a
3 TRCN0000271203 GCGGCAAGAACATACGAATTG pLKO_005 1138 CDS 100% 10.800 15.120 N Pip5k1a n/a
4 TRCN0000024515 CCATTACAATGACTTTCGATT pLKO.1 830 CDS 100% 4.950 6.930 N Pip5k1a n/a
5 TRCN0000024518 GCTTCCAGGATACTACATGAA pLKO.1 1055 CDS 100% 4.950 3.960 N Pip5k1a n/a
6 TRCN0000024514 GCCCGGAATAACAAAGGAGAA pLKO.1 1596 CDS 100% 4.050 3.240 N Pip5k1a n/a
7 TRCN0000024517 GCCTCTGTCATGCCTGTTAAA pLKO.1 600 CDS 100% 13.200 9.240 N Pip5k1a n/a
8 TRCN0000271202 GACCTGAAGGGTTCAACTTAC pLKO_005 1209 CDS 100% 10.800 7.560 N Pip5k1a n/a
9 TRCN0000024516 CCATTGATTGAACTCTCCAAT pLKO.1 939 CDS 100% 4.950 3.465 N Pip5k1a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_008847.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07233 pDONR223 100% 79.2% 83.3% None (many diffs) n/a
2 ccsbBroad304_07233 pLX_304 0% 79.2% 83.3% V5 (many diffs) n/a
3 TRCN0000466603 ATCACCACTCATATCAAGTCGACA pLX_317 24.4% 79.2% 83.3% V5 (many diffs) n/a
4 ccsbBroadEn_14891 pDONR223 0% 79.2% 83.3% None (many diffs) n/a
5 ccsbBroad304_14891 pLX_304 0% 79.2% 83.3% V5 (many diffs) n/a
6 TRCN0000488868 CCATATAGGAAATTTCAAACAAAT pLX_317 22.3% 79.2% 83.3% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_10588 pDONR223 100% 48.2% 48.4% None (many diffs) n/a
8 ccsbBroad304_10588 pLX_304 0% 48.2% 48.4% V5 (many diffs) n/a
9 TRCN0000479417 GACGAAACCCTTTCATATAAAGAT pLX_317 11.8% 48.2% 48.4% V5 (many diffs) n/a
Download CSV