Construct: ORF TRCN0000467337
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF008782.1_s317c1
- Derived from:
- ccsbBroadEn_12651
- DNA Barcode:
- CACGTATATACCTACTTTCAATTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- WLS (79971)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000467337
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 79971 | WLS | Wnt ligand secretion mediator | NM_001193334.1 | 93.8% | 93.3% | (many diffs) |
2 | human | 79971 | WLS | Wnt ligand secretion mediator | XM_017002390.2 | 88.8% | 88.9% | 1_165del;297G>A |
3 | human | 79971 | WLS | Wnt ligand secretion mediator | XM_011542192.3 | 82.3% | 80.3% | (many diffs) |
4 | human | 79971 | WLS | Wnt ligand secretion mediator | NM_024911.7 | 81.4% | 81.5% | 1_300del;432G>A |
5 | human | 79971 | WLS | Wnt ligand secretion mediator | NM_001002292.3 | 75.9% | 74.1% | (many diffs) |
6 | human | 79971 | WLS | Wnt ligand secretion mediator | XM_011542191.2 | 75.6% | 73.9% | (many diffs) |
7 | mouse | 68151 | Wls | wntless homolog (Drosophila) | NM_026582.4 | 73.6% | 79.8% | (many diffs) |
8 | mouse | 68151 | Wls | wntless homolog (Drosophila) | XM_006501964.2 | 73.6% | 79.8% | (many diffs) |
9 | mouse | 68151 | Wls | wntless homolog (Drosophila) | NR_037590.1 | 43% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1389
- ORF length:
- 1323
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga gatgagtcct tggttccaat tcatgctgtt tatcctgcag ctggacattg 121 ccttcaagct aaacaaccaa atcagagaaa atgcagaagt ctccatggac gtttccctgg 181 cttaccgtga tgacgcattt gctgagtgga ctgaaatggc ccatgaaaga gtaccacgga 241 aactcaaatg caccttcaca tctcccaaga ctccagagca tgagggccgt tactatgaat 301 gtgatgtcct tcctttcatg gaaattgggt ctgtggccca taagttttac cttttaaaca 361 tccggctgcc tgtgaatgag aagaagaaaa tcaatgtggg aattggggag ataaaggata 421 tccggttggt ggggatccac caaaatggag gcttcaccaa ggtgtggttt gccatgaaga 481 ccttccttac gcccagcatc ttcatcatta tggtgtggta ttggaggagg atcaccatga 541 tgtcccgacc cccagtgctt ctggaaaaag tcatctttgc ccttgggatt tccatgacct 601 ttatcaatat cccagtggaa tggttttcca tcgggtttga ctggacctgg atgctgctgt 661 ttggtgacat ccgacagggc atcttctatg cgatgcttct gtccttctgg atcatcttct 721 gtggcgagca catgatggat cagcacgagc ggaaccacat cgcagggtat tggaagcaag 781 tcggacccat tgccgttggc tccttctgcc tcttcatatt tgacatgtgt gagagagggg 841 tacaactcac gaatcccttc tacagtatct ggactacaga cattggaaca gagctggcca 901 tggccttcat catcgtggct ggaatctgcc tctgcctcta cttcctgttt ctatgcttca 961 tggtatttca ggtgtttcgg aacatcagtg ggAAGCAGTC CAGCCTGCCA GCTATGAGCA 1021 AAGTCCGGCG GCTACACTAT GAGGGGCTAA TTTTTAGGTT CAAGTTCCTC ATGCTTATCA 1081 CCTTGGCCTG CGCTGCCATG ACTGTCATCT TCTTCATCGT TAGTCAGGTA ACGGAAGGCC 1141 ATTGGAAATG GGGCGGCGTC ACAGTCCAAG TGAACAGTGC CTTTTTCACA GGCATCTATG 1201 GGATGTGGAA TCTGTATGTC TTTGCTCTGA TGTTCTTGTA TGCACCATCC CATAAAAACT 1261 ATGGAGAAGA CCAGTCCAAT GGCGATCTGG GTGTCCATAG TGGGGAAGAA CTCCAGCTCA 1321 CCACCACTAT CACCCATGTG GACGGACCCA CTGAGATCTA CAAGTTGACC CGCAAGGAGG 1381 CCCAGGAGTA CCTAACTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC 1441 CTCTCCTCGG TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA 1501 TTTCTTGGCT TTATATATCT TGTGGAAAGG ACGACACGTA TATACCTACT TTCAATTGAC 1561 GCGTTAAGTC gacaatcaac ctctggatta caaaatttgt gaaagatt