Transcript: Human NM_001329115.1

Homo sapiens BRISC and BRCA1 A complex member 2 (BABAM2), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
BABAM2 (9577)
Length:
2029
CDS:
319..1641

Additional Resources:

NCBI RefSeq record:
NM_001329115.1
NBCI Gene record:
BABAM2 (9577)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001329115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000221082 GCCCGTAGATTTCAGCAATAT pLKO.1 849 CDS 100% 13.200 18.480 N BABAM2 n/a
2 TRCN0000221085 GCTGTACTTGTCACCTCGAAT pLKO.1 972 CDS 100% 4.950 6.930 N BABAM2 n/a
3 TRCN0000221086 GCCTCCTGGAATCCTTCAAAT pLKO.1 625 CDS 100% 13.200 9.240 N BABAM2 n/a
4 TRCN0000221083 GCTGCTGATGTGGAAAGATTT pLKO.1 1215 CDS 100% 13.200 9.240 N BABAM2 n/a
5 TRCN0000246488 GGCACAGGTGTCGTGGAATAT pLKO_005 1165 CDS 100% 13.200 9.240 N Babam2 n/a
6 TRCN0000246487 GTGGGACTGGATGCTACAAAC pLKO_005 397 CDS 100% 10.800 7.560 N Babam2 n/a
7 TRCN0000221084 CCCTCAGCTTTGCAGAATCTT pLKO.1 604 CDS 100% 5.625 3.375 N BABAM2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001329115.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02202 pDONR223 100% 87% 86.8% None 1089_1259del n/a
2 ccsbBroad304_02202 pLX_304 0% 87% 86.8% V5 (not translated due to frame shift) 1089_1259del n/a
3 TRCN0000467617 CATCATGGTCCGACTACATGCCCG pLX_317 7.3% 87% 86.8% V5 (not translated due to prior stop codon) 1089_1259del n/a
Download CSV