Transcript: Mouse NM_181280.1

Mus musculus BRISC and BRCA1 A complex member 2 (Babam2), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Mus musculus (mouse)
Gene:
Babam2 (107976)
Length:
1308
CDS:
89..1213

Additional Resources:

NCBI RefSeq record:
NM_181280.1
NBCI Gene record:
Babam2 (107976)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_181280.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246491 ATTGAAGTTACCAGTAGATTT pLKO_005 583 CDS 100% 13.200 18.480 N Babam2 n/a
2 TRCN0000246490 TTCAGTCAGTCTATCACTTTA pLKO_005 1041 CDS 100% 13.200 18.480 N Babam2 n/a
3 TRCN0000175984 GATTTCATCTTTGGAGAGGAT pLKO.1 308 CDS 100% 2.640 2.112 N Babam2 n/a
4 TRCN0000216037 CAAGAGAGCAAAGGCTTATTT pLKO.1 1138 CDS 100% 15.000 10.500 N Babam2 n/a
5 TRCN0000246488 GGCACAGGTGTCGTGGAATAT pLKO_005 908 CDS 100% 13.200 9.240 N Babam2 n/a
6 TRCN0000175540 CCAGTAGATTTCAGCAACATT pLKO.1 593 CDS 100% 5.625 3.938 N Babam2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_181280.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02202 pDONR223 100% 84.1% 85% None (many diffs) n/a
2 ccsbBroad304_02202 pLX_304 0% 84.1% 85% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000467617 CATCATGGTCCGACTACATGCCCG pLX_317 7.3% 84.1% 85% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV