Construct: ORF TRCN0000468247
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018981.3_s317c1
- Derived from:
- ccsbBroadEn_15306
- DNA Barcode:
- CTGCTTTATCTCTTCTTTGGTTAA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NRBP2 (340371)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468247
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 340371 | NRBP2 | nuclear receptor binding pr... | NM_178564.4 | 51% | 50.4% | (many diffs) |
| 2 | human | 340371 | NRBP2 | nuclear receptor binding pr... | XM_017013382.1 | 44.5% | 37.1% | (many diffs) |
| 3 | human | 340371 | NRBP2 | nuclear receptor binding pr... | XM_017013381.2 | 43.1% | 40.1% | (many diffs) |
| 4 | human | 340371 | NRBP2 | nuclear receptor binding pr... | XM_017013380.1 | 42.1% | 35.2% | (many diffs) |
| 5 | human | 340371 | NRBP2 | nuclear receptor binding pr... | XM_017013383.1 | 41.1% | 38.1% | (many diffs) |
| 6 | human | 340371 | NRBP2 | nuclear receptor binding pr... | XR_001745528.1 | 39.4% | (many diffs) | |
| 7 | human | 340371 | NRBP2 | nuclear receptor binding pr... | XM_017013378.1 | 38.6% | 32.3% | (many diffs) |
| 8 | human | 340371 | NRBP2 | nuclear receptor binding pr... | XR_001745529.1 | 38.1% | (many diffs) | |
| 9 | human | 340371 | NRBP2 | nuclear receptor binding pr... | XM_017013379.1 | 37.5% | 34.8% | (many diffs) |
| 10 | mouse | 223649 | Nrbp2 | nuclear receptor binding pr... | NM_144847.1 | 86.3% | 92.2% | (many diffs) |
| 11 | mouse | 223649 | Nrbp2 | nuclear receptor binding pr... | XM_006520772.3 | 44.6% | 47.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 843
- ORF length:
- 774
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtgtgcgctg gagatggctg tactggaaat ccagaccaat ggggacaccn 121 gggtcacaga ggagnccatt nntcgcgcca ggcactcgnt nagtgacccc aacatgcggg 181 agttcntcct ttgctgcctg gcccgggacc ctgcccgccg gccctctgcc cacagcctcc 241 tcttccaccg cgtgctcttc gaggtgcact cgctgaagct cctggcagcc cactgcttca 301 tccagcacca gtacctcatg cctgagaatg tggtggagga gaagaccaag gccatggacc 361 tgcacgcggt cttggcggag cttccccggc cccgcaggcc cccgctgcag tggcggtact 421 cggaagtctc cttcatggag ctggacaaat tcctggagga tgtcaggaat ggaatctacc 481 cactgatgaa ctttgcagcc actcgacccc tggggctgcc ccgtgtgctg gccccacccc 541 cggaggaggt ccaaaaggcc aagaccccga cgccagagcc ctttgactct gagaccagaa 601 aggtcatcca gatgcagtgc aaccTGGAGA GAAGCGAGGA CAAGGCGCGC TGGCATCTCA 661 CTCTGCTTCT GGTGCTGGAA GACCGGCTGC ACCGGCAGCT GACCTACGAC CTGCTCCCAA 721 CGGACAGCGC CCAGGACCTC GCCTCGGAGC TCGTGCACTA TGGCTTCCTC CACGAGGACG 781 ACCGGATGAA GCTGGCCGCC TTCCTGGAGA GCACCTTCCT CAAGTACCGT GGGACCCAGG 841 CCTTGCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 901 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 961 GGCTTTATAT ATCTTGTGGA AAGGACGACT GCTTTATCTC TTCTTTGGTT AAACGCGTTA 1021 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt