Transcript: Human XM_017013379.1

PREDICTED: Homo sapiens nuclear receptor binding protein 2 (NRBP2), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NRBP2 (340371)
Length:
2256
CDS:
141..1979

Additional Resources:

NCBI RefSeq record:
XM_017013379.1
NBCI Gene record:
NRBP2 (340371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017013379.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197184 GTACTCGGAAGTCTCCTTCAT pLKO.1 1217 CDS 100% 4.950 6.930 N NRBP2 n/a
2 TRCN0000021401 CTACCCACTGATGAACTTTGC pLKO.1 1277 CDS 100% 4.050 5.670 N NRBP2 n/a
3 TRCN0000021402 ATGAACTTTGCAGCCACTCGA pLKO.1 1287 CDS 100% 2.640 3.696 N NRBP2 n/a
4 TRCN0000021400 CCTTCATGGAGCTGGACAAAT pLKO.1 1231 CDS 100% 13.200 9.240 N NRBP2 n/a
5 TRCN0000199700 CTTCCTCAAGTACCGTGGGAC pLKO.1 1560 CDS 100% 0.720 0.504 N NRBP2 n/a
6 TRCN0000021403 ATGTCAGGAATGGAATCTACC pLKO.1 1261 CDS 100% 4.050 2.430 N NRBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017013379.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13598 pDONR223 100% 37.9% 35.6% None 1_729del;1381_1382ins56;1448_1836del n/a
2 ccsbBroad304_13598 pLX_304 0% 37.9% 35.6% V5 1_729del;1381_1382ins56;1448_1836del n/a
3 TRCN0000489360 GATGATTGTCGATGCACTCTCCTC pLX_317 49.9% 37.9% 35.6% V5 (not translated due to prior stop codon) 1_729del;1381_1382ins56;1448_1836del n/a
4 TRCN0000468247 CTGCTTTATCTCTTCTTTGGTTAA pLX_317 28.7% 37.5% 34.8% V5 (many diffs) n/a
5 ccsbBroadEn_15306 pDONR223 100% 37.4% 36.1% None (many diffs) n/a
6 ccsbBroad304_15306 pLX_304 0% 37.4% 36.1% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV