Transcript: Human NM_178564.4

Homo sapiens nuclear receptor binding protein 2 (NRBP2), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
NRBP2 (340371)
Length:
3724
CDS:
140..1645

Additional Resources:

NCBI RefSeq record:
NM_178564.4
NBCI Gene record:
NRBP2 (340371)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_178564.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197184 GTACTCGGAAGTCTCCTTCAT pLKO.1 1216 CDS 100% 4.950 6.930 N NRBP2 n/a
2 TRCN0000021401 CTACCCACTGATGAACTTTGC pLKO.1 1276 CDS 100% 4.050 5.670 N NRBP2 n/a
3 TRCN0000021402 ATGAACTTTGCAGCCACTCGA pLKO.1 1286 CDS 100% 2.640 3.696 N NRBP2 n/a
4 TRCN0000196994 GCGCATTCATGCCTTTCTAAA pLKO.1 2662 3UTR 100% 13.200 10.560 N NRBP2 n/a
5 TRCN0000021399 CCAGCCAGATAATACATGATA pLKO.1 3125 3UTR 100% 5.625 4.500 N NRBP2 n/a
6 TRCN0000195525 CCCTAAGGACTCATGAGATTA pLKO.1 3096 3UTR 100% 13.200 9.240 N NRBP2 n/a
7 TRCN0000021400 CCTTCATGGAGCTGGACAAAT pLKO.1 1230 CDS 100% 13.200 9.240 N NRBP2 n/a
8 TRCN0000199700 CTTCCTCAAGTACCGTGGGAC pLKO.1 1615 CDS 100% 0.720 0.504 N NRBP2 n/a
9 TRCN0000021403 ATGTCAGGAATGGAATCTACC pLKO.1 1260 CDS 100% 4.050 2.430 N NRBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_178564.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13598 pDONR223 100% 51.4% 51.4% None 1_729del n/a
2 ccsbBroad304_13598 pLX_304 0% 51.4% 51.4% V5 1_729del n/a
3 TRCN0000489360 GATGATTGTCGATGCACTCTCCTC pLX_317 49.9% 51.4% 51.4% V5 (not translated due to prior stop codon) 1_729del n/a
4 TRCN0000468247 CTGCTTTATCTCTTCTTTGGTTAA pLX_317 28.7% 51% 50.4% V5 (many diffs) n/a
5 ccsbBroadEn_15306 pDONR223 100% 50.8% 46.4% None (many diffs) n/a
6 ccsbBroad304_15306 pLX_304 0% 50.8% 46.4% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV