Transcript: Mouse XM_006520772.3

PREDICTED: Mus musculus nuclear receptor binding protein 2 (Nrbp2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nrbp2 (223649)
Length:
3159
CDS:
102..1601

Additional Resources:

NCBI RefSeq record:
XM_006520772.3
NBCI Gene record:
Nrbp2 (223649)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006520772.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362019 CATCGGCAGCTGACCTATGAT pLKO_005 1446 CDS 100% 5.625 4.500 N Nrbp2 n/a
2 TRCN0000222228 CGGGATCTATCCACTGATGAA pLKO.1 1226 CDS 100% 4.950 3.960 N Nrbp2 n/a
3 TRCN0000222230 CGCTGCTGAACTAGTGCATTA pLKO.1 1496 CDS 100% 0.000 0.000 N Nrbp2 n/a
4 TRCN0000222232 CCTTCTTGGAGCTGGACAAAT pLKO.1 1186 CDS 100% 13.200 9.240 N Nrbp2 n/a
5 TRCN0000363360 CTTCTTGGAGCTGGACAAATT pLKO_005 1187 CDS 100% 13.200 9.240 N Nrbp2 n/a
6 TRCN0000378575 GCCTTCAGGTGGCATAGAAAC pLKO_005 1862 3UTR 100% 10.800 7.560 N Nrbp2 n/a
7 TRCN0000222229 CTGAGAATGTGGTAGAGGAAA pLKO.1 1078 CDS 100% 4.950 3.465 N Nrbp2 n/a
8 TRCN0000362074 ATGTCAGGAACGGGATCTATC pLKO_005 1216 CDS 100% 10.800 6.480 N Nrbp2 n/a
9 TRCN0000222231 GCACGAGGATGACAGGACAAA pLKO.1 1526 CDS 100% 4.950 2.970 N Nrbp2 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2505 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006520772.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13598 pDONR223 100% 45% 48.6% None (many diffs) n/a
2 ccsbBroad304_13598 pLX_304 0% 45% 48.6% V5 (many diffs) n/a
3 TRCN0000489360 GATGATTGTCGATGCACTCTCCTC pLX_317 49.9% 45% 48.6% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000468247 CTGCTTTATCTCTTCTTTGGTTAA pLX_317 28.7% 44.6% 47.6% V5 (many diffs) n/a
5 ccsbBroadEn_15306 pDONR223 100% 44.4% 43.8% None (many diffs) n/a
6 ccsbBroad304_15306 pLX_304 0% 44.4% 43.8% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV