Transcript: Human XR_001745529.1

PREDICTED: Homo sapiens nuclear receptor binding protein 2 (NRBP2), transcript variant X7, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NRBP2 (340371)
Length:
2010
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001745529.1
NBCI Gene record:
NRBP2 (340371)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001745529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000197184 GTACTCGGAAGTCTCCTTCAT pLKO.1 1217 3UTR 100% 4.950 6.930 N NRBP2 n/a
2 TRCN0000021401 CTACCCACTGATGAACTTTGC pLKO.1 1277 3UTR 100% 4.050 5.670 N NRBP2 n/a
3 TRCN0000021402 ATGAACTTTGCAGCCACTCGA pLKO.1 1287 3UTR 100% 2.640 3.696 N NRBP2 n/a
4 TRCN0000021400 CCTTCATGGAGCTGGACAAAT pLKO.1 1231 3UTR 100% 13.200 9.240 N NRBP2 n/a
5 TRCN0000199700 CTTCCTCAAGTACCGTGGGAC pLKO.1 1707 3UTR 100% 0.720 0.504 N NRBP2 n/a
6 TRCN0000021403 ATGTCAGGAATGGAATCTACC pLKO.1 1261 3UTR 100% 4.050 2.430 N NRBP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001745529.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13598 pDONR223 100% 38.5% None 1_869del;1522_1612del;1735_2010del n/a
2 ccsbBroad304_13598 pLX_304 0% 38.5% V5 1_869del;1522_1612del;1735_2010del n/a
3 TRCN0000489360 GATGATTGTCGATGCACTCTCCTC pLX_317 49.9% 38.5% V5 (not translated due to prior stop codon) 1_869del;1522_1612del;1735_2010del n/a
4 TRCN0000468247 CTGCTTTATCTCTTCTTTGGTTAA pLX_317 28.7% 38.1% V5 (many diffs) n/a
5 ccsbBroadEn_15306 pDONR223 100% 38% None (many diffs) n/a
6 ccsbBroad304_15306 pLX_304 0% 38% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV