Construct: ORF TRCN0000468580
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010497.1_s317c1
- Derived from:
- ccsbBroadEn_15426
- DNA Barcode:
- CTGTGCATCTCCCGATGGCTGTAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- GGT1 (2678)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468580
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 728226 | GGTLC3 | gamma-glutamyltransferase l... | NM_001355479.1 | 97% | 92% | (many diffs) |
| 2 | human | 728441 | GGT2 | gamma-glutamyltransferase 2 | XM_011530621.2 | 97% | 91.5% | (many diffs) |
| 3 | human | 728441 | GGT2 | gamma-glutamyltransferase 2 | XM_017029185.1 | 97% | 91.5% | (many diffs) |
| 4 | human | 92086 | GGTLC1 | gamma-glutamyltransferase l... | NM_178311.3 | 96.5% | 94.6% | (many diffs) |
| 5 | human | 92086 | GGTLC1 | gamma-glutamyltransferase l... | NM_178312.3 | 96.5% | 94.6% | (many diffs) |
| 6 | human | 92086 | GGTLC1 | gamma-glutamyltransferase l... | XM_005260865.4 | 96.5% | 94.6% | (many diffs) |
| 7 | human | 92086 | GGTLC1 | gamma-glutamyltransferase l... | XM_017028126.2 | 96.5% | 94.6% | (many diffs) |
| 8 | human | 91227 | GGTLC2 | gamma-glutamyltransferase l... | NM_199127.2 | 93.2% | 88.8% | (many diffs) |
| 9 | human | 91227 | GGTLC2 | gamma-glutamyltransferase l... | XM_024452301.1 | 93.2% | 88.8% | (many diffs) |
| 10 | human | 91227 | GGTLC2 | gamma-glutamyltransferase l... | NM_001282879.1 | 87.6% | 86.5% | (many diffs) |
| 11 | human | 91227 | GGTLC2 | gamma-glutamyltransferase l... | XM_005261817.3 | 87.6% | 86.5% | (many diffs) |
| 12 | human | 91227 | GGTLC2 | gamma-glutamyltransferase l... | XM_011530497.1 | 87.6% | 86.5% | (many diffs) |
| 13 | human | 728226 | GGTLC3 | gamma-glutamyltransferase l... | XM_024452264.1 | 86.6% | 82.1% | (many diffs) |
| 14 | human | 728441 | GGT2 | gamma-glutamyltransferase 2 | XM_006724396.2 | 86.6% | 81.7% | (many diffs) |
| 15 | human | 102724197 | LOC102724197 | inactive glutathione hydrol... | XM_006724929.2 | 86.6% | 81.7% | (many diffs) |
| 16 | human | 728441 | GGT2 | gamma-glutamyltransferase 2 | XM_017029184.1 | 86.6% | 81.7% | (many diffs) |
| 17 | human | 92086 | GGTLC1 | gamma-glutamyltransferase l... | XM_005260863.4 | 86.2% | 84.5% | (many diffs) |
| 18 | human | 92086 | GGTLC1 | gamma-glutamyltransferase l... | XM_005260864.4 | 86.2% | 84.5% | (many diffs) |
| 19 | human | 92086 | GGTLC1 | gamma-glutamyltransferase l... | XM_011529391.3 | 86.2% | 84.5% | (many diffs) |
| 20 | human | 91227 | GGTLC2 | gamma-glutamyltransferase l... | XM_005261818.2 | 84.6% | 80.6% | (many diffs) |
| 21 | human | 92086 | GGTLC1 | gamma-glutamyltransferase l... | XM_011529392.2 | 83.5% | 81.7% | (many diffs) |
| 22 | human | 92086 | GGTLC1 | gamma-glutamyltransferase l... | XM_011529393.2 | 83.5% | 81.7% | (many diffs) |
| 23 | human | 91227 | GGTLC2 | gamma-glutamyltransferase l... | XM_005261815.3 | 80.3% | 79.2% | (many diffs) |
| 24 | human | 728441 | GGT2 | gamma-glutamyltransferase 2 | XM_005261890.4 | 68% | 64.1% | (many diffs) |
| 25 | human | 102724197 | LOC102724197 | inactive glutathione hydrol... | XM_006724928.3 | 68% | 64.1% | (many diffs) |
| 26 | human | 728441 | GGT2 | gamma-glutamyltransferase 2 | XM_017029183.1 | 68% | 64.1% | (many diffs) |
| 27 | human | 102724197 | LOC102724197 | inactive glutathione hydrol... | XM_017030145.2 | 58.8% | 55.5% | (many diffs) |
| 28 | human | 728441 | GGT2 | gamma-glutamyltransferase 2 | XM_006724395.4 | 54.2% | 51.1% | (many diffs) |
| 29 | human | 728441 | GGT2 | gamma-glutamyltransferase 2 | XM_017029182.2 | 53% | 50% | (many diffs) |
| 30 | human | 728441 | GGT2 | gamma-glutamyltransferase 2 | XM_006724392.3 | 49.7% | 46.9% | (many diffs) |
| 31 | human | 102724197 | LOC102724197 | inactive glutathione hydrol... | XM_006724924.4 | 49.7% | 46.9% | (many diffs) |
| 32 | human | 728441 | GGT2 | gamma-glutamyltransferase 2 | XM_017029179.2 | 49.7% | 46.9% | (many diffs) |
| 33 | human | 728441 | GGT2 | gamma-glutamyltransferase 2 | XM_017029180.1 | 49.7% | 46.9% | (many diffs) |
| 34 | human | 728441 | GGT2 | gamma-glutamyltransferase 2 | XM_017029181.2 | 49.7% | 46.9% | (many diffs) |
| 35 | human | 102724197 | LOC102724197 | inactive glutathione hydrol... | XM_017030144.1 | 49.7% | 46.9% | (many diffs) |
| 36 | human | 102724197 | LOC102724197 | inactive glutathione hydrol... | XM_017030143.2 | 44.5% | 42% | (many diffs) |
| 37 | human | 102724197 | LOC102724197 | inactive glutathione hydrol... | XM_006724921.4 | 42.2% | 39.8% | (many diffs) |
| 38 | human | 102724197 | LOC102724197 | inactive glutathione hydrol... | XM_017030136.2 | 42.2% | 39.8% | (many diffs) |
| 39 | human | 102724197 | LOC102724197 | inactive glutathione hydrol... | XM_017030137.2 | 42.2% | 39.8% | (many diffs) |
| 40 | human | 102724197 | LOC102724197 | inactive glutathione hydrol... | XM_017030140.2 | 42.2% | 39.8% | (many diffs) |
| 41 | human | 102724197 | LOC102724197 | inactive glutathione hydrol... | XM_017030141.2 | 42.2% | 39.8% | (many diffs) |
| 42 | human | 102724197 | LOC102724197 | inactive glutathione hydrol... | XM_017030142.2 | 42.2% | 39.8% | (many diffs) |
| 43 | human | 2678 | GGT1 | gamma-glutamyltransferase 1 | NM_001288833.2 | 39.3% | 39% | (many diffs) |
| 44 | human | 2678 | GGT1 | gamma-glutamyltransferase 1 | NM_013421.3 | 39.3% | 39% | (many diffs) |
| 45 | human | 2678 | GGT1 | gamma-glutamyltransferase 1 | NM_013430.2 | 39.3% | 39% | (many diffs) |
| 46 | human | 102724197 | LOC102724197 | inactive glutathione hydrol... | XM_011546256.3 | 38.4% | 36.2% | (many diffs) |
| 47 | human | 728441 | GGT2 | gamma-glutamyltransferase 2 | NM_001351304.1 | 38% | 35.8% | (many diffs) |
| 48 | human | 728441 | GGT2 | gamma-glutamyltransferase 2 | XM_017029186.2 | 38% | 35.8% | (many diffs) |
| 49 | human | 2679 | GGT3P | gamma-glutamyltransferase 3... | NR_003267.1 | 32.2% | (many diffs) | |
| 50 | human | 102724823 | LOC102724823 | inactive glutathione hydrol... | XR_002958856.1 | 17.8% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 741
- ORF length:
- 675
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgac ctctgagttc ttcgctgccc agctccgggc ccagatctct gacgacacca 121 ctcacccgat ctcctactac aagcccgagt tctacacgcc ggatgacggg ggcactgctc 181 acctgtctgt cgtcgcagag gacggcagtg ctgtgtccgc caccagcacc atcaacctct 241 actttggctc caaggtccgc tccccggtca gcgggatcct gttcaataat gaaatggacg 301 acttcagctc tcccagcatc accaacgagt ttggggtacc cccctcacct gccaatttca 361 tccagccagg gAAGCAGCCG CTCTCGTCCA TGTGCCCGAC GATCGTGGTG GGCCAGGACG 421 GCCAGGTCCG GATGGTGGTG GGAGCTGCTG GGGGCACACA GATCACCACG GCCACTGCAC 481 TGGCCATCAT CTACAACCTC TGGTTCGGCT ATGACGTGAA GCGGACCGTG GAGGAGCCCC 541 GGCTGCACAA CCAGCTTCTG CCCAACGTCA CGACAGTGGA GAGAAACATT GACCAGGCAG 601 TGACTGCAGC CCTGGAGACC CGGCACCATC ACACCCAGAT CGCGTCCACC TTCATCGCTG 661 TGGTGCAAGC CATCGTCCGC ACGGCTGGTG GCTGGGCAGC TGCCTCGGAC TCCAGGAAAG 721 GCGGGGAGCC TGCCGCCTAC TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 781 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 841 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGACTGT GCATCTCCCG 901 ATGGCTGTAC ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt