Transcript: Human NM_199127.2

Homo sapiens gamma-glutamyltransferase light chain 2 (GGTLC2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-21
Taxon:
Homo sapiens (human)
Gene:
GGTLC2 (91227)
Length:
855
CDS:
35..691

Additional Resources:

NCBI RefSeq record:
NM_199127.2
NBCI Gene record:
GGTLC2 (91227)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_199127.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118484 AGCGAGATCCTGTTCAATGAT pLKO.1 239 CDS 100% 5.625 3.938 N GGTLC2 n/a
2 TRCN0000118486 GTCAGCGAGATCCTGTTCAAT pLKO.1 236 CDS 100% 5.625 3.375 N GGTLC2 n/a
3 TRCN0000118483 CAATGATGAAATGGATGACTT pLKO.1 253 CDS 100% 4.950 2.970 N GGTLC2 n/a
4 TRCN0000118422 CCCAACATCACCAACGAGTTT pLKO.1 281 CDS 100% 4.950 2.970 N LOC440819 n/a
5 TRCN0000118485 CCTGTTCAATGATGAAATGGA pLKO.1 247 CDS 100% 3.000 1.800 N GGTLC2 n/a
6 TRCN0000370351 GCACCATCAACCTCTACTTTG pLKO_005 195 CDS 100% 10.800 5.400 Y GGTLC1 n/a
7 TRCN0000306949 GGACAAGGCTGACAAGCAATC pLKO_005 703 3UTR 100% 6.000 3.000 Y GGT1 n/a
8 TRCN0000034518 AGCACCATCAACCTCTACTTT pLKO.1 194 CDS 100% 5.625 2.813 Y GGT3P n/a
9 TRCN0000370352 CCCTCACCTGCCAATTTCATC pLKO_005 311 CDS 100% 4.950 2.475 Y GGTLC1 n/a
10 TRCN0000370353 CTCACCCGATCTCCTACTACA pLKO_005 90 CDS 100% 4.950 2.475 Y GGTLC1 n/a
11 TRCN0000118426 TCACCCGATCTCCTACTACAA pLKO.1 91 CDS 100% 4.950 2.475 Y LOC440819 n/a
12 TRCN0000035773 CATCATCTACAACCTCTGGTT pLKO.1 433 CDS 100% 2.640 1.320 Y GGTLC1 n/a
13 TRCN0000118482 CCAGGAGGACAAGGCTGACAA pLKO.1 697 3UTR 100% 1.650 0.825 Y GGTLC2 n/a
14 TRCN0000035770 GAGAGAAACATTGACCAGGAA pLKO.1 527 CDS 100% 2.640 1.320 Y GGTLC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_199127.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09311 pDONR223 100% 99.8% 99.5% None 209A>G n/a
2 TRCN0000480852 CCGCTCGGTCCTACGGAGCGTTCA pLX_317 59% 99.8% 99.5% V5 209A>G n/a
3 ccsbBroadEn_10846 pDONR223 100% 93.6% 90.2% None (many diffs) n/a
4 ccsbBroad304_10846 pLX_304 0% 93.6% 90.2% V5 (many diffs) n/a
5 TRCN0000470995 TTTTATAAGTCTGACATTTAGAAT pLX_317 58.5% 93.6% 90.2% V5 (many diffs) n/a
6 ccsbBroadEn_15427 pDONR223 0% 93.5% 90.2% None (many diffs) n/a
7 ccsbBroad304_15427 pLX_304 0% 93.5% 90.2% V5 (many diffs) n/a
8 TRCN0000473857 CTTATTAAATCCAATATGGTTCCG pLX_317 57.3% 93.5% 90.2% V5 (many diffs) n/a
9 ccsbBroadEn_15426 pDONR223 0% 93.3% 89.3% None (many diffs) n/a
10 ccsbBroad304_15426 pLX_304 0% 93.3% 89.3% V5 (many diffs) n/a
11 TRCN0000468580 CTGTGCATCTCCCGATGGCTGTAC pLX_317 54.6% 93.2% 88.8% V5 (many diffs) n/a
12 ccsbBroadEn_04568 pDONR223 100% 90.7% 87.1% None (many diffs) n/a
13 ccsbBroad304_04568 pLX_304 0% 90.7% 87.1% V5 (many diffs) n/a
14 TRCN0000471296 ATGGGTATTATCCTTACCTTACGT pLX_317 67.9% 90.7% 87.1% V5 (many diffs) n/a
Download CSV