Transcript: Human NM_001282879.1

Homo sapiens gamma-glutamyltransferase light chain 2 (GGTLC2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-05
Taxon:
Homo sapiens (human)
Gene:
GGTLC2 (91227)
Length:
985
CDS:
63..821

Additional Resources:

NCBI RefSeq record:
NM_001282879.1
NBCI Gene record:
GGTLC2 (91227)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282879.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118484 AGCGAGATCCTGTTCAATGAT pLKO.1 267 CDS 100% 5.625 3.938 N GGTLC2 n/a
2 TRCN0000118486 GTCAGCGAGATCCTGTTCAAT pLKO.1 264 CDS 100% 5.625 3.375 N GGTLC2 n/a
3 TRCN0000118483 CAATGATGAAATGGATGACTT pLKO.1 281 CDS 100% 4.950 2.970 N GGTLC2 n/a
4 TRCN0000118422 CCCAACATCACCAACGAGTTT pLKO.1 309 CDS 100% 4.950 2.970 N LOC440819 n/a
5 TRCN0000118485 CCTGTTCAATGATGAAATGGA pLKO.1 275 CDS 100% 3.000 1.800 N GGTLC2 n/a
6 TRCN0000370351 GCACCATCAACCTCTACTTTG pLKO_005 223 CDS 100% 10.800 5.400 Y GGTLC1 n/a
7 TRCN0000306949 GGACAAGGCTGACAAGCAATC pLKO_005 833 3UTR 100% 6.000 3.000 Y GGT1 n/a
8 TRCN0000034518 AGCACCATCAACCTCTACTTT pLKO.1 222 CDS 100% 5.625 2.813 Y GGT3P n/a
9 TRCN0000370352 CCCTCACCTGCCAATTTCATC pLKO_005 339 CDS 100% 4.950 2.475 Y GGTLC1 n/a
10 TRCN0000370353 CTCACCCGATCTCCTACTACA pLKO_005 118 CDS 100% 4.950 2.475 Y GGTLC1 n/a
11 TRCN0000118426 TCACCCGATCTCCTACTACAA pLKO.1 119 CDS 100% 4.950 2.475 Y LOC440819 n/a
12 TRCN0000035773 CATCATCTACAACCTCTGGTT pLKO.1 563 CDS 100% 2.640 1.320 Y GGTLC1 n/a
13 TRCN0000118482 CCAGGAGGACAAGGCTGACAA pLKO.1 827 3UTR 100% 1.650 0.825 Y GGTLC2 n/a
14 TRCN0000035770 GAGAGAAACATTGACCAGGAA pLKO.1 657 CDS 100% 2.640 1.320 Y GGTLC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282879.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10846 pDONR223 100% 88% 87.6% None (many diffs) n/a
2 ccsbBroad304_10846 pLX_304 0% 88% 87.6% V5 (many diffs) n/a
3 TRCN0000470995 TTTTATAAGTCTGACATTTAGAAT pLX_317 58.5% 88% 87.6% V5 (many diffs) n/a
4 ccsbBroadEn_15427 pDONR223 0% 87.9% 87.6% None (many diffs) n/a
5 ccsbBroad304_15427 pLX_304 0% 87.9% 87.6% V5 (many diffs) n/a
6 TRCN0000473857 CTTATTAAATCCAATATGGTTCCG pLX_317 57.3% 87.9% 87.6% V5 (many diffs) n/a
7 ccsbBroadEn_15426 pDONR223 0% 87.8% 86.9% None (many diffs) n/a
8 ccsbBroad304_15426 pLX_304 0% 87.8% 86.9% V5 (many diffs) n/a
9 TRCN0000468580 CTGTGCATCTCCCGATGGCTGTAC pLX_317 54.6% 87.6% 86.5% V5 (many diffs) n/a
10 ccsbBroadEn_09311 pDONR223 100% 86.3% 86.1% None 209A>G;358_459del n/a
11 TRCN0000480852 CCGCTCGGTCCTACGGAGCGTTCA pLX_317 59% 86.3% 86.1% V5 209A>G;358_459del n/a
12 ccsbBroadEn_04568 pDONR223 100% 85.7% 84.1% None (many diffs) n/a
13 ccsbBroad304_04568 pLX_304 0% 85.7% 84.1% V5 (many diffs) n/a
14 TRCN0000471296 ATGGGTATTATCCTTACCTTACGT pLX_317 67.9% 85.7% 84.1% V5 (many diffs) n/a
Download CSV