Transcript: Human XM_006724395.4

PREDICTED: Homo sapiens gamma-glutamyltransferase 2 (GGT2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GGT2 (728441)
Length:
1621
CDS:
244..1455

Additional Resources:

NCBI RefSeq record:
XM_006724395.4
NBCI Gene record:
GGT2 (728441)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_006724395.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365285 GAACCTGCTGGCTACTGATTG pLKO_005 1438 CDS 100% 10.800 5.400 Y GGTLC1 n/a
2 TRCN0000370351 GCACCATCAACCTCTACTTTG pLKO_005 857 CDS 100% 10.800 5.400 Y GGTLC1 n/a
3 TRCN0000294177 TCATCCTCAACATCCTCAAAG pLKO_005 527 CDS 100% 10.800 5.400 Y GGT1 n/a
4 TRCN0000034518 AGCACCATCAACCTCTACTTT pLKO.1 856 CDS 100% 5.625 2.813 Y GGT3P n/a
5 TRCN0000370352 CCCTCACCTGCCAATTTCATC pLKO_005 973 CDS 100% 4.950 2.475 Y GGTLC1 n/a
6 TRCN0000370353 CTCACCCGATCTCCTACTACA pLKO_005 752 CDS 100% 4.950 2.475 Y GGTLC1 n/a
7 TRCN0000118426 TCACCCGATCTCCTACTACAA pLKO.1 753 CDS 100% 4.950 2.475 Y LOC440819 n/a
8 TRCN0000034515 CCTCATCCTCAACATCCTCAA pLKO.1 525 CDS 100% 4.050 2.025 Y GGT3P n/a
9 TRCN0000035773 CATCATCTACAACCTCTGGTT pLKO.1 1197 CDS 100% 2.640 1.320 Y GGTLC1 n/a
10 TRCN0000034516 CCCAAGTTTGTGGATGTGACT pLKO.1 661 CDS 100% 2.640 1.320 Y GGT3P n/a
11 TRCN0000035770 GAGAGAAACATTGACCAGGAA pLKO.1 1291 CDS 100% 2.640 1.320 Y GGTLC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006724395.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10846 pDONR223 100% 54.4% 51.8% None (many diffs) n/a
2 ccsbBroad304_10846 pLX_304 0% 54.4% 51.8% V5 (many diffs) n/a
3 TRCN0000470995 TTTTATAAGTCTGACATTTAGAAT pLX_317 58.5% 54.4% 51.8% V5 (many diffs) n/a
4 ccsbBroadEn_15427 pDONR223 0% 54.3% 51.8% None (many diffs) n/a
5 ccsbBroad304_15427 pLX_304 0% 54.3% 51.8% V5 (many diffs) n/a
6 TRCN0000473857 CTTATTAAATCCAATATGGTTCCG pLX_317 57.3% 54.3% 51.8% V5 (many diffs) n/a
7 ccsbBroadEn_15426 pDONR223 0% 54.2% 51.3% None (many diffs) n/a
8 ccsbBroad304_15426 pLX_304 0% 54.2% 51.3% V5 (many diffs) n/a
9 TRCN0000468580 CTGTGCATCTCCCGATGGCTGTAC pLX_317 54.6% 54.2% 51.1% V5 (many diffs) n/a
10 ccsbBroadEn_04568 pDONR223 100% 53.3% 49.6% None (many diffs) n/a
11 ccsbBroad304_04568 pLX_304 0% 53.3% 49.6% V5 (many diffs) n/a
12 TRCN0000471296 ATGGGTATTATCCTTACCTTACGT pLX_317 67.9% 53.3% 49.6% V5 (many diffs) n/a
13 ccsbBroadEn_09311 pDONR223 100% 52.2% 49.6% None (many diffs) n/a
14 TRCN0000480852 CCGCTCGGTCCTACGGAGCGTTCA pLX_317 59% 52.2% 49.6% V5 (many diffs) n/a
Download CSV