Transcript: Human NM_001018089.3

Homo sapiens interactor of little elongation complex ELL subunit 2 (ICE2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ICE2 (79664)
Length:
7046
CDS:
484..3021

Additional Resources:

NCBI RefSeq record:
NM_001018089.3
NBCI Gene record:
ICE2 (79664)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001018089.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152950 GCACCAGACATTTCTGCTAAT pLKO.1 1408 CDS 100% 10.800 15.120 N ICE2 n/a
2 TRCN0000153176 GCTCAGCAAGTTGAAACTGAA pLKO.1 2968 CDS 100% 4.950 3.960 N ICE2 n/a
3 TRCN0000157640 CCAGACCAGCTAGTCCAAATT pLKO.1 1874 CDS 100% 13.200 9.240 N ICE2 n/a
4 TRCN0000153157 GCCACTGCTGAAGATGATTAT pLKO.1 3415 3UTR 100% 13.200 9.240 N ICE2 n/a
5 TRCN0000152505 GCTGATGGTGAAAGACCTAAT pLKO.1 1681 CDS 100% 10.800 7.560 N ICE2 n/a
6 TRCN0000152747 GCTACCATTGAAACGTCAGAA pLKO.1 811 CDS 100% 4.950 3.465 N ICE2 n/a
7 TRCN0000150652 GCTTGCATTGAACAAGTGAAA pLKO.1 613 CDS 100% 4.950 3.465 N ICE2 n/a
8 TRCN0000150506 GATGATTATGAGCATCGCAAA pLKO.1 3427 3UTR 100% 4.050 2.835 N ICE2 n/a
9 TRCN0000156804 GCAGAGGAGTTATGTGGACTT pLKO.1 384 5UTR 100% 4.050 2.835 N ICE2 n/a
10 TRCN0000158028 CCACAGGAATCCAGTTTCCAT pLKO.1 2922 CDS 100% 3.000 2.100 N ICE2 n/a
11 TRCN0000151110 GCTGAAGATGATTATGAGCAT pLKO.1 3421 3UTR 100% 2.640 1.848 N ICE2 n/a
12 TRCN0000153322 GCTCTGACTGAAAGTGAACTT pLKO.1 2425 CDS 100% 4.950 2.970 N ICE2 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 4058 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000136382 CACCTGTAATTCCAGCACTTT pLKO.1 4249 3UTR 100% 4.950 2.475 Y CENPL n/a
15 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 4058 3UTR 100% 5.625 2.813 Y EID2B n/a
16 TRCN0000157610 GTGGCATGATCTCAGCTCATT pLKO.1 3855 3UTR 100% 4.950 2.475 Y CCNJL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001018089.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12587 pDONR223 100% 39.2% 39.2% None 1_1539del;1932T>C n/a
2 TRCN0000468764 ATAATGACACAGGATGTCATCAAC pLX_317 41% 39.2% 39.2% V5 1_1539del;1932T>C n/a
Download CSV