Transcript: Human XM_017012806.1

PREDICTED: Homo sapiens cAMP responsive element binding protein 5 (CREB5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CREB5 (9586)
Length:
8263
CDS:
143..1648

Additional Resources:

NCBI RefSeq record:
XM_017012806.1
NBCI Gene record:
CREB5 (9586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017012806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271308 TATGCGAACAGTAGCAATTTA pLKO_005 6262 3UTR 100% 15.000 12.000 N CREB5 n/a
2 TRCN0000013486 GCGGAATATCTCGATGCATAA pLKO.1 409 CDS 100% 10.800 8.640 N CREB5 n/a
3 TRCN0000271310 AGACCTGAATCCGATTCTTTA pLKO_005 1627 CDS 100% 13.200 9.240 N CREB5 n/a
4 TRCN0000271247 GATGCCAATGGAGCGACAAAT pLKO_005 706 CDS 100% 13.200 9.240 N CREB5 n/a
5 TRCN0000271307 CAATATGTTATCAGATCAAAC pLKO_005 277 CDS 100% 10.800 7.560 N CREB5 n/a
6 TRCN0000013485 GCCATGCAGAAAGAATCACAA pLKO.1 1454 CDS 100% 4.950 3.465 N CREB5 n/a
7 TRCN0000013483 CCAGATAAACACACAGCCTTT pLKO.1 2116 3UTR 100% 4.050 2.835 N CREB5 n/a
8 TRCN0000271249 AGCTGAAACAGTTGTTGTTAA pLKO_005 1410 CDS 100% 13.200 7.920 N CREB5 n/a
9 TRCN0000013487 GCAACAAGTCATCCAGCATAA pLKO.1 1531 CDS 100% 10.800 6.480 N CREB5 n/a
10 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 3221 3UTR 100% 1.080 0.540 Y GPR83 n/a
11 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 3221 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017012806.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11393 pDONR223 100% 66.6% 66.6% None 1_501del n/a
2 ccsbBroad304_11393 pLX_304 0% 66.6% 66.6% V5 1_501del n/a
3 TRCN0000469202 ATTCAGAAACACATTAAATCAATT pLX_317 48% 66.6% 66.6% V5 1_501del n/a
Download CSV