Transcript: Human NM_001011666.3

Homo sapiens cAMP responsive element binding protein 5 (CREB5), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
CREB5 (9586)
Length:
7743
CDS:
19..1128

Additional Resources:

NCBI RefSeq record:
NM_001011666.3
NBCI Gene record:
CREB5 (9586)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001011666.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271308 TATGCGAACAGTAGCAATTTA pLKO_005 5742 3UTR 100% 15.000 12.000 N CREB5 n/a
2 TRCN0000271310 AGACCTGAATCCGATTCTTTA pLKO_005 1107 CDS 100% 13.200 9.240 N CREB5 n/a
3 TRCN0000271247 GATGCCAATGGAGCGACAAAT pLKO_005 186 CDS 100% 13.200 9.240 N CREB5 n/a
4 TRCN0000013485 GCCATGCAGAAAGAATCACAA pLKO.1 934 CDS 100% 4.950 3.465 N CREB5 n/a
5 TRCN0000013483 CCAGATAAACACACAGCCTTT pLKO.1 1596 3UTR 100% 4.050 2.835 N CREB5 n/a
6 TRCN0000271249 AGCTGAAACAGTTGTTGTTAA pLKO_005 890 CDS 100% 13.200 7.920 N CREB5 n/a
7 TRCN0000013487 GCAACAAGTCATCCAGCATAA pLKO.1 1011 CDS 100% 10.800 6.480 N CREB5 n/a
8 TRCN0000008902 CCTCCCAAAGTGTTGGGATTA pLKO.1 2701 3UTR 100% 1.080 0.540 Y GPR83 n/a
9 TRCN0000156315 CCTCCCAAAGTGTTGGGATTA pLKO.1 2701 3UTR 100% 1.080 0.540 Y MYORG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001011666.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11393 pDONR223 100% 90.5% 90.5% None 1_105del n/a
2 ccsbBroad304_11393 pLX_304 0% 90.5% 90.5% V5 1_105del n/a
3 TRCN0000469202 ATTCAGAAACACATTAAATCAATT pLX_317 48% 90.5% 90.5% V5 1_105del n/a
Download CSV