Construct: ORF TRCN0000469284
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF016759.1_s317c1
- Derived from:
- ccsbBroadEn_11176
- DNA Barcode:
- ACGCAAGGCACAAAAGCACTCACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TCF4 (6925)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469284
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 6925 | TCF4 | transcription factor 4 | NM_001369571.1 | 54.7% | 54.7% | 1096_2001del |
| 2 | human | 6925 | TCF4 | transcription factor 4 | NM_001369572.1 | 54.7% | 54.7% | 1096_2001del |
| 3 | human | 6925 | TCF4 | transcription factor 4 | NM_003199.3 | 54.7% | 54.7% | 1096_2001del |
| 4 | human | 6925 | TCF4 | transcription factor 4 | NM_001369573.1 | 54.5% | 54.5% | 366_367insCAG;1093_1998del |
| 5 | human | 6925 | TCF4 | transcription factor 4 | NM_001369574.1 | 54.5% | 54.5% | 1066_1067insCAG;1093_1998del |
| 6 | human | 6925 | TCF4 | transcription factor 4 | NM_001083962.2 | 54.3% | 54.3% | 1096_2013del |
| 7 | human | 6925 | TCF4 | transcription factor 4 | NM_001369567.1 | 54.3% | 54.3% | 1096_2013del |
| 8 | human | 6925 | TCF4 | transcription factor 4 | NM_001369568.1 | 54.3% | 54.3% | 1096_2013del |
| 9 | human | 6925 | TCF4 | transcription factor 4 | NM_001330604.3 | 54.2% | 54.2% | 1066_1067insCAG;1093_2010del |
| 10 | human | 6925 | TCF4 | transcription factor 4 | NM_001369569.1 | 54.2% | 54.2% | 366_367insCAG;1093_2010del |
| 11 | human | 6925 | TCF4 | transcription factor 4 | NM_001369570.1 | 54.2% | 54.2% | 366_367insCAG;1093_2010del |
| 12 | human | 6925 | TCF4 | transcription factor 4 | NM_001243228.2 | 53.9% | 53.9% | 550_567del;1114_2031del |
| 13 | human | 6925 | TCF4 | transcription factor 4 | NM_001243230.1 | 52.2% | 51.5% | (many diffs) |
| 14 | human | 6925 | TCF4 | transcription factor 4 | NM_001306207.1 | 51.1% | 51.1% | 0_1ins72;1024_1929del |
| 15 | human | 6925 | TCF4 | transcription factor 4 | NM_001348219.2 | 51.1% | 51.1% | 0_1ins72;1024_1929del |
| 16 | human | 6925 | TCF4 | transcription factor 4 | NM_001369582.1 | 51.1% | 51.1% | 0_1ins72;1024_1929del |
| 17 | human | 6925 | TCF4 | transcription factor 4 | NM_001369583.1 | 51.1% | 51.1% | 0_1ins72;1024_1929del |
| 18 | human | 6925 | TCF4 | transcription factor 4 | NM_001348220.1 | 50.9% | 50.9% | 0_1ins72;294_295insCAG;1021_1926del |
| 19 | human | 6925 | TCF4 | transcription factor 4 | NM_001369584.1 | 50.9% | 50.9% | 0_1ins72;294_295insCAG;1021_1926del |
| 20 | human | 6925 | TCF4 | transcription factor 4 | NM_001369585.1 | 50.9% | 50.9% | 0_1ins72;294_295insCAG;1021_1926del |
| 21 | human | 6925 | TCF4 | transcription factor 4 | XM_017025950.2 | 50.8% | 50.8% | (many diffs) |
| 22 | human | 6925 | TCF4 | transcription factor 4 | NM_001243227.2 | 50.8% | 50.8% | 0_1ins72;1024_1941del |
| 23 | human | 6925 | TCF4 | transcription factor 4 | NM_001348217.1 | 50.8% | 50.8% | 0_1ins72;1024_1941del |
| 24 | human | 6925 | TCF4 | transcription factor 4 | NM_001348218.2 | 50.8% | 50.8% | 0_1ins72;1024_1941del |
| 25 | human | 6925 | TCF4 | transcription factor 4 | NM_001369575.1 | 50.8% | 50.8% | 0_1ins72;1024_1941del |
| 26 | human | 6925 | TCF4 | transcription factor 4 | NM_001369586.1 | 50.7% | 50.5% | 0_1ins72;998_1000delGTA;1027_1944del |
| 27 | human | 6925 | TCF4 | transcription factor 4 | NM_001369576.1 | 50.6% | 50.6% | 0_1ins72;294_295insCAG;1021_1938del |
| 28 | human | 6925 | TCF4 | transcription factor 4 | NM_001369577.1 | 50.6% | 50.6% | 0_1ins72;994_995insCAG;1021_1938del |
| 29 | human | 6925 | TCF4 | transcription factor 4 | NM_001369578.1 | 50.6% | 50.6% | 0_1ins72;294_295insCAG;1021_1938del |
| 30 | human | 6925 | TCF4 | transcription factor 4 | NM_001369579.1 | 50.6% | 50.6% | 0_1ins72;994_995insCAG;1021_1938del |
| 31 | human | 6925 | TCF4 | transcription factor 4 | NM_001369580.1 | 50.6% | 50.6% | 0_1ins72;994_995insCAG;1021_1938del |
| 32 | human | 6925 | TCF4 | transcription factor 4 | NM_001369581.1 | 50.6% | 50.6% | 0_1ins72;294_295insCAG;1021_1938del |
| 33 | human | 6925 | TCF4 | transcription factor 4 | XM_006722538.3 | 50.6% | 50.6% | 0_1ins72;294_295insCAG;1021_1938del |
| 34 | human | 6925 | TCF4 | transcription factor 4 | NM_001243231.2 | 48.2% | 47.3% | (many diffs) |
| 35 | human | 6925 | TCF4 | transcription factor 4 | NM_001348211.2 | 47.9% | 47% | (many diffs) |
| 36 | human | 6925 | TCF4 | transcription factor 4 | XM_017025951.2 | 47.7% | 46.9% | (many diffs) |
| 37 | human | 6925 | TCF4 | transcription factor 4 | NM_001243226.3 | 47.2% | 47.2% | 1_306del;1402_2319del |
| 38 | human | 6925 | TCF4 | transcription factor 4 | XM_024451241.1 | 42.6% | 42.6% | 0_1ins237;859_1776del |
| 39 | human | 6925 | TCF4 | transcription factor 4 | XM_017025953.2 | 41.9% | 38.7% | (many diffs) |
| 40 | human | 6925 | TCF4 | transcription factor 4 | NM_001306208.1 | 41.7% | 38.5% | (many diffs) |
| 41 | human | 6925 | TCF4 | transcription factor 4 | XM_005266749.4 | 41.6% | 38.5% | (many diffs) |
| 42 | human | 6925 | TCF4 | transcription factor 4 | NM_001243232.1 | 41.5% | 38.3% | (many diffs) |
| 43 | human | 6925 | TCF4 | transcription factor 4 | XM_017025952.2 | 41.4% | 38.2% | (many diffs) |
| 44 | human | 6925 | TCF4 | transcription factor 4 | NM_001243233.2 | 35.2% | 35.2% | 0_1ins390;706_1611del |
| 45 | human | 6925 | TCF4 | transcription factor 4 | NM_001348212.2 | 35.2% | 35.2% | 0_1ins390;706_1611del |
| 46 | human | 6925 | TCF4 | transcription factor 4 | XM_017025956.2 | 35.2% | 35.2% | 0_1ins390;706_1611del |
| 47 | human | 6925 | TCF4 | transcription factor 4 | NM_001330605.3 | 35% | 35% | 0_1ins390;706_1623del |
| 48 | human | 6925 | TCF4 | transcription factor 4 | NM_001348213.2 | 35% | 35% | 0_1ins390;706_1623del |
| 49 | human | 6925 | TCF4 | transcription factor 4 | XM_005266752.5 | 35% | 35% | 0_1ins390;706_1623del |
| 50 | human | 6925 | TCF4 | transcription factor 4 | XM_005266755.5 | 35% | 35% | 0_1ins390;706_1623del |
| 51 | human | 6925 | TCF4 | transcription factor 4 | XM_017025954.2 | 34.8% | 34.8% | 0_1ins390;676_677insCAG;703_1620del |
| 52 | human | 6925 | TCF4 | transcription factor 4 | NM_001243236.2 | 29.9% | 27.5% | (many diffs) |
| 53 | human | 6925 | TCF4 | transcription factor 4 | NM_001348216.2 | 29.7% | 27.4% | (many diffs) |
| 54 | human | 6925 | TCF4 | transcription factor 4 | NM_001243235.2 | 29.3% | 27.1% | (many diffs) |
| 55 | human | 6925 | TCF4 | transcription factor 4 | NM_001348214.2 | 29.1% | 27% | (many diffs) |
| 56 | human | 6925 | TCF4 | transcription factor 4 | NM_001243234.2 | 29.1% | 27% | (many diffs) |
| 57 | human | 6925 | TCF4 | transcription factor 4 | XM_005266761.4 | 28.9% | 26.8% | (many diffs) |
| 58 | human | 6925 | TCF4 | transcription factor 4 | NM_001348215.2 | 22.2% | 22.2% | 0_1ins648;448_1365del |
| 59 | mouse | 21413 | Tcf4 | transcription factor 4 | NM_001083967.1 | 51.3% | 53.6% | (many diffs) |
| 60 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525750.3 | 51.3% | 53.6% | (many diffs) |
| 61 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_017317857.1 | 51.3% | 53.6% | (many diffs) |
| 62 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525751.3 | 51.1% | 53.5% | (many diffs) |
| 63 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525752.3 | 51.1% | 53.5% | (many diffs) |
| 64 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_017317858.1 | 51% | 53.3% | (many diffs) |
| 65 | mouse | 21413 | Tcf4 | transcription factor 4 | NM_013685.2 | 51% | 53.3% | (many diffs) |
| 66 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525746.3 | 51% | 53.3% | (many diffs) |
| 67 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525747.3 | 51% | 53.3% | (many diffs) |
| 68 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525748.3 | 50.8% | 53.2% | (many diffs) |
| 69 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525749.3 | 50.8% | 53.2% | (many diffs) |
| 70 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_017317854.1 | 50.8% | 53.2% | (many diffs) |
| 71 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_017317855.1 | 50.8% | 53.2% | (many diffs) |
| 72 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_017317856.1 | 50.7% | 53% | (many diffs) |
| 73 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525753.3 | 47.4% | 49.7% | (many diffs) |
| 74 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_017317859.1 | 47.2% | 49.6% | (many diffs) |
| 75 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_017317861.1 | 32.6% | 34.6% | (many diffs) |
| 76 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525757.3 | 32.4% | 34.4% | (many diffs) |
| 77 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525759.3 | 32.4% | 34.4% | (many diffs) |
| 78 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_017317860.1 | 32.4% | 34.4% | (many diffs) |
| 79 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_017317863.1 | 32.4% | 34.4% | (many diffs) |
| 80 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525762.3 | 27.8% | 26.7% | (many diffs) |
| 81 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525760.3 | 27.6% | 26.5% | (many diffs) |
| 82 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525766.3 | 27.5% | 26.4% | (many diffs) |
| 83 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525763.3 | 27.2% | 27.1% | (many diffs) |
| 84 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525761.3 | 27% | 26.9% | (many diffs) |
| 85 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_017317862.1 | 20.4% | 22% | (many diffs) |
| 86 | mouse | 21413 | Tcf4 | transcription factor 4 | XM_006525764.3 | 20.3% | 21.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1161
- ORF length:
- 1095
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca tcaccaacag cgaatggctg ccttagggac ggacaaagag ctgagtgatt 121 tactggattt cagtgcgatg ttttcacctc ctgtgagcag tgggaaaaat ggaccaactt 181 ctttggcaag tggacatttt actggctcaa atgtagaaga cagaagtagc tcagggtcct 241 gggggaatgg aggacatcca agcccgtcca ggaactatgg agatgggact ccctatgacc 301 acatgaccag cagggacctt gggtcacatg acaatctctc tccacctttt gtcaattcca 361 gaatacaaag taaaacagaa aggggctcat actcatctta tgggagagaa tcaaacttac 421 agggttgcca ccagcagagt ctccttggag gtgacatgga tatgggcaac ccaggaaccc 481 tttcgcccac caaacctggt tcccagtact atcagtattc tagcaataat ccccgaagga 541 ggcctcttca cagtagtgcc atggaggtac agacaaagaa agttcgaaaa gttcctccag 601 gtttgccatc ttcagtctat gctccatcag caagcactgc cgactacaat agggactcgc 661 caggctatcc ttcctccaaa ccagcaacca gcactttccc tagctccTTC TTCATGCAAG 721 ATGGCCATCA CAGCAGTGAC CCTTGGAGCT CCTCCAGTGG GATGAATCAG CCTGGCTATG 781 CAGGAATGTT GGGCAACTCT TCTCATATTC CACAGTCCAG CAGCTACTGT AGCCTGCATC 841 CACATGAACG TTTGAGCTAT CCATCACACT CCTCAGCAGA CATCAATTCC AGTCTTCCTC 901 CGATGTCCAC TTTCCATCGT AGTGGTACAA ACCATTACAG CACCTCTTCC TGTACGCCTC 961 CTGCCAACGG GACAGACAGT ATAATGGCAA ATAGAGGAAG CGGGGCAGCC GGCAGCTCCC 1021 AGACTGGAGA TGCTCTGGGG AAAGCACTTG CTTCGATCTA TTCTCCAGAT CACACTAACA 1081 ACAGCTTTTC ATCAAACCCT TCAACTCCTG TTGGCTCTCC TCCATCTCTC TCAGCAGGCA 1141 CAGCTGTTTG GTCTAGAAAT TGCCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 1201 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 1261 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAACGC AAGGCACAAA 1321 AGCACTCACT ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt