Transcript: Mouse XM_006525764.3

PREDICTED: Mus musculus transcription factor 4 (Tcf4), transcript variant X23, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tcf4 (21413)
Length:
3039
CDS:
510..1877

Additional Resources:

NCBI RefSeq record:
XM_006525764.3
NBCI Gene record:
Tcf4 (21413)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525764.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360448 GTTTCAGCATTCCCAATTATC pLKO_005 2030 3UTR 100% 13.200 18.480 N Tcf4 n/a
2 TRCN0000360446 TCGTAGTGGCACAAACCATTA pLKO_005 713 CDS 100% 10.800 15.120 N Tcf4 n/a
3 TRCN0000012097 CCGAGATATCAACGAGGCTTT pLKO.1 1604 CDS 100% 4.050 5.670 N Tcf4 n/a
4 TRCN0000012095 GCCTCGTCATCTCCCAATTAT pLKO.1 966 CDS 100% 15.000 12.000 N Tcf4 n/a
5 TRCN0000360516 CCAACGGAACAGACAGTATAA pLKO_005 760 CDS 100% 13.200 10.560 N Tcf4 n/a
6 TRCN0000012093 CGTCAGCTAGTGTTTCTAATT pLKO.1 2371 3UTR 100% 13.200 10.560 N Tcf4 n/a
7 TRCN0000235556 TAGGTCAAGATCTAGCAATAA pLKO_005 1496 CDS 100% 13.200 10.560 N Tcf4 n/a
8 TRCN0000235555 GAACGGAGGATGGCCAATAAT pLKO_005 1563 CDS 100% 15.000 10.500 N Tcf4 n/a
9 TRCN0000235553 CCTCGTCATCTCCCAATTATG pLKO_005 967 CDS 100% 13.200 9.240 N Tcf4 n/a
10 TRCN0000235552 CTGGTAGCTCTGAGATCAAAT pLKO_005 1384 CDS 100% 13.200 9.240 N Tcf4 n/a
11 TRCN0000360515 GGAGCAGCAAGTTCGAGAAAG pLKO_005 1724 CDS 100% 10.800 7.560 N Tcf4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525764.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07036 pDONR223 100% 61.8% 66.6% None (many diffs) n/a
2 ccsbBroad304_07036 pLX_304 26.8% 61.8% 66.6% V5 (many diffs) n/a
3 TRCN0000491625 GACTCGGAGTCTTCTAGGCAACCT pLX_317 17.5% 61.8% 66.6% V5 (many diffs) n/a
4 TRCN0000488472 GACCCCTACTCCGCTAGGAGTACC pLX_317 14.8% 61.3% 66% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_15607 pDONR223 0% 61.2% 66% None (many diffs) n/a
6 ccsbBroad304_15607 pLX_304 0% 61.2% 66% V5 (many diffs) n/a
7 TRCN0000479737 GCCATGAGCTAGGTAGAGGATTAG pLX_317 21.2% 61.2% 65.8% V5 (many diffs) n/a
8 ccsbBroadEn_11176 pDONR223 100% 20.3% 21.9% None (many diffs) n/a
9 ccsbBroad304_11176 pLX_304 0% 20.3% 21.9% V5 (many diffs) n/a
10 TRCN0000469284 ACGCAAGGCACAAAAGCACTCACT pLX_317 41.6% 20.3% 21.9% V5 (many diffs) n/a
Download CSV