Transcript: Mouse XM_006525763.3

PREDICTED: Mus musculus transcription factor 4 (Tcf4), transcript variant X22, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tcf4 (21413)
Length:
16498
CDS:
10121..11644

Additional Resources:

NCBI RefSeq record:
XM_006525763.3
NBCI Gene record:
Tcf4 (21413)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006525763.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000360448 GTTTCAGCATTCCCAATTATC pLKO_005 11797 3UTR 100% 13.200 18.480 N Tcf4 n/a
2 TRCN0000360446 TCGTAGTGGCACAAACCATTA pLKO_005 10492 CDS 100% 10.800 15.120 N Tcf4 n/a
3 TRCN0000012097 CCGAGATATCAACGAGGCTTT pLKO.1 11371 CDS 100% 4.050 5.670 N Tcf4 n/a
4 TRCN0000012095 GCCTCGTCATCTCCCAATTAT pLKO.1 10745 CDS 100% 15.000 12.000 N Tcf4 n/a
5 TRCN0000360516 CCAACGGAACAGACAGTATAA pLKO_005 10539 CDS 100% 13.200 10.560 N Tcf4 n/a
6 TRCN0000012093 CGTCAGCTAGTGTTTCTAATT pLKO.1 12138 3UTR 100% 13.200 10.560 N Tcf4 n/a
7 TRCN0000235555 GAACGGAGGATGGCCAATAAT pLKO_005 11330 CDS 100% 15.000 10.500 N Tcf4 n/a
8 TRCN0000235554 TGTTACTTGTGATGCAATTAA pLKO_005 15718 3UTR 100% 15.000 10.500 N Tcf4 n/a
9 TRCN0000235553 CCTCGTCATCTCCCAATTATG pLKO_005 10746 CDS 100% 13.200 9.240 N Tcf4 n/a
10 TRCN0000235552 CTGGTAGCTCTGAGATCAAAT pLKO_005 11163 CDS 100% 13.200 9.240 N Tcf4 n/a
11 TRCN0000360515 GGAGCAGCAAGTTCGAGAAAG pLKO_005 11491 CDS 100% 10.800 7.560 N Tcf4 n/a
12 TRCN0000086233 CCTTCCTTTCTTTCTTTCTTT pLKO.1 5064 5UTR 100% 5.625 2.813 Y Pou1f1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006525763.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488472 GACCCCTACTCCGCTAGGAGTACC pLX_317 14.8% 68.2% 71% V5 (not translated due to prior stop codon) (many diffs) n/a
2 ccsbBroadEn_15607 pDONR223 0% 68.2% 71% None (many diffs) n/a
3 ccsbBroad304_15607 pLX_304 0% 68.2% 71% V5 (many diffs) n/a
4 TRCN0000479737 GCCATGAGCTAGGTAGAGGATTAG pLX_317 21.2% 68.1% 70.9% V5 (many diffs) n/a
5 ccsbBroadEn_07036 pDONR223 100% 67.8% 70.6% None (many diffs) n/a
6 ccsbBroad304_07036 pLX_304 26.8% 67.8% 70.6% V5 (many diffs) n/a
7 TRCN0000491625 GACTCGGAGTCTTCTAGGCAACCT pLX_317 17.5% 67.8% 70.6% V5 (many diffs) n/a
8 ccsbBroadEn_11176 pDONR223 100% 27.2% 27.1% None (many diffs) n/a
9 ccsbBroad304_11176 pLX_304 0% 27.2% 27.1% V5 (many diffs) n/a
10 TRCN0000469284 ACGCAAGGCACAAAAGCACTCACT pLX_317 41.6% 27.2% 27.1% V5 (many diffs) n/a
Download CSV