Transcript: Human NM_001369579.1

Homo sapiens transcription factor 4 (TCF4), transcript variant 39, mRNA.

Source:
NCBI, updated 2019-08-27
Taxon:
Homo sapiens (human)
Gene:
TCF4 (6925)
Length:
7946
CDS:
156..2096

Additional Resources:

NCBI RefSeq record:
NM_001369579.1
NBCI Gene record:
TCF4 (6925)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001369579.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000274162 CAACGGGACAGACAGTATAAT pLKO_005 983 CDS 100% 15.000 21.000 N TCF4 n/a
2 TRCN0000274161 CTATCAGTATTCTAGCAATAA pLKO_005 527 CDS 100% 13.200 18.480 N TCF4 n/a
3 TRCN0000360448 GTTTCAGCATTCCCAATTATC pLKO_005 2247 3UTR 100% 13.200 18.480 N Tcf4 n/a
4 TRCN0000235556 TAGGTCAAGATCTAGCAATAA pLKO_005 1715 CDS 100% 13.200 18.480 N Tcf4 n/a
5 TRCN0000274213 GAGACTGAACGGCAATCTTTC pLKO_005 2381 3UTR 100% 10.800 15.120 N TCF4 n/a
6 TRCN0000015037 CACGAAATCTTCGGAGGACAA pLKO.1 1655 CDS 100% 4.050 5.670 N TCF4 n/a
7 TRCN0000274214 CACGAAATCTTCGGAGGACAA pLKO_005 1655 CDS 100% 4.050 5.670 N TCF4 n/a
8 TRCN0000015036 GAAAGGAATCTGAATCCGAAA pLKO.1 1959 CDS 100% 4.050 3.240 N TCF4 n/a
9 TRCN0000274163 GAAAGGAATCTGAATCCGAAA pLKO_005 1959 CDS 100% 4.050 3.240 N TCF4 n/a
10 TRCN0000235554 TGTTACTTGTGATGCAATTAA pLKO_005 5920 3UTR 100% 15.000 10.500 N Tcf4 n/a
11 TRCN0000015035 CGAATTGAAGATCGTTTAGAA pLKO.1 1233 CDS 100% 5.625 3.938 N TCF4 n/a
12 TRCN0000015033 CCACATAAACACTTCTCCTTA pLKO.1 2168 3UTR 100% 4.950 3.465 N TCF4 n/a
13 TRCN0000015034 GCAGACATCAATTCCAGTCTT pLKO.1 894 CDS 100% 4.950 3.465 N TCF4 n/a
14 TRCN0000012096 CCCAGTACTATCAGTATTCAA pLKO.1 520 CDS 100% 5.625 3.375 N Tcf4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001369579.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07036 pDONR223 100% 96.2% 96.2% None 0_1ins72;994_995insCAG;1866A>G n/a
2 ccsbBroad304_07036 pLX_304 26.8% 96.2% 96.2% V5 0_1ins72;994_995insCAG;1866A>G n/a
3 TRCN0000491625 GACTCGGAGTCTTCTAGGCAACCT pLX_317 17.5% 96.2% 96.2% V5 0_1ins72;994_995insCAG;1866A>G n/a
4 TRCN0000488472 GACCCCTACTCCGCTAGGAGTACC pLX_317 14.8% 95.6% 95.6% V5 (not translated due to prior stop codon) 0_1ins72;994_995insCAG;1559_1570del n/a
5 ccsbBroadEn_15607 pDONR223 0% 95.6% 95.6% None (many diffs) n/a
6 ccsbBroad304_15607 pLX_304 0% 95.6% 95.6% V5 (many diffs) n/a
7 TRCN0000479737 GCCATGAGCTAGGTAGAGGATTAG pLX_317 21.2% 95.5% 95.5% V5 (many diffs) n/a
8 ccsbBroadEn_11176 pDONR223 100% 50.6% 50.6% None 0_1ins72;994_995insCAG;1021_1938del n/a
9 ccsbBroad304_11176 pLX_304 0% 50.6% 50.6% V5 0_1ins72;994_995insCAG;1021_1938del n/a
10 TRCN0000469284 ACGCAAGGCACAAAAGCACTCACT pLX_317 41.6% 50.6% 50.6% V5 0_1ins72;994_995insCAG;1021_1938del n/a
Download CSV