Construct: ORF TRCN0000469306
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004573.1_s317c1
- Derived from:
- ccsbBroadEn_03880
- DNA Barcode:
- AACGATTACCCTCGTCGGAACCGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- RXFP1 (59350)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000469306
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_021634.4 | 100% | 100% | |
2 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008518.2 | 99.8% | 99.8% | 1043_1044insCAG |
3 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_011532176.2 | 96.8% | 96.8% | 754_755ins72 |
4 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_001253727.1 | 96.5% | 96.4% | 287_367del |
5 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_011532174.1 | 96.4% | 96.3% | 287_367del;1124_1125insCAG |
6 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_001253728.2 | 95.6% | 95.5% | 187_188ins99 |
7 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_001253729.2 | 93.6% | 93.5% | 898_899ins144 |
8 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_011532175.1 | 93.4% | 93.3% | 287_367del;835_836ins72 |
9 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008517.1 | 93.3% | 93.2% | 287_367del;835_836ins72;1052_1053insCAG |
10 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_001363776.1 | 89.2% | 89.2% | 0_1ins243 |
11 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008522.1 | 89.1% | 89.1% | 0_1ins243;800_801insCAG |
12 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008519.1 | 86.2% | 86% | 0_1ins243;44_124del |
13 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008520.1 | 86.2% | 86% | 0_1ins243;44_124del |
14 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_001253730.1 | 82.6% | 82.6% | 0_1ins390;653_654insCAG |
15 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_001253732.2 | 81.2% | 79.1% | (many diffs) |
16 | human | 59350 | RXFP1 | relaxin family peptide rece... | NM_001253733.1 | 78% | 75.9% | (many diffs) |
17 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008526.1 | 78% | 75.9% | (many diffs) |
18 | human | 59350 | RXFP1 | relaxin family peptide rece... | NR_045584.2 | 66.7% | (many diffs) | |
19 | human | 59350 | RXFP1 | relaxin family peptide rece... | NR_045581.2 | 61.2% | 1_95del;282_305del;2391_3710del | |
20 | human | 59350 | RXFP1 | relaxin family peptide rece... | NR_045580.2 | 60.7% | 1_95del;282_334del;2420_3739del | |
21 | human | 59350 | RXFP1 | relaxin family peptide rece... | NR_045583.2 | 56.5% | (many diffs) | |
22 | human | 59350 | RXFP1 | relaxin family peptide rece... | NR_045582.2 | 56.1% | (many diffs) | |
23 | human | 59350 | RXFP1 | relaxin family peptide rece... | NR_045579.2 | 49.7% | (many diffs) | |
24 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008523.2 | 49.6% | 49.4% | (many diffs) |
25 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_011532179.2 | 47.9% | 47.5% | (many diffs) |
26 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008524.2 | 46.5% | 46.2% | (many diffs) |
27 | human | 59350 | RXFP1 | relaxin family peptide rece... | XM_017008525.1 | 45.3% | 44.9% | (many diffs) |
28 | mouse | 381489 | Rxfp1 | relaxin/insulin-like family... | NM_212452.1 | 85.9% | 85% | (many diffs) |
29 | mouse | 381489 | Rxfp1 | relaxin/insulin-like family... | XM_006501629.2 | 85.7% | 84.9% | (many diffs) |
30 | mouse | 381489 | Rxfp1 | relaxin/insulin-like family... | XM_006501630.2 | 71.8% | 71.8% | (many diffs) |
31 | mouse | 381489 | Rxfp1 | relaxin/insulin-like family... | XR_375538.2 | 24.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 2340
- ORF length:
- 2271
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gacatctggt tctgtcttct tctacatctt aatttttgga aaatattttt 121 ctcatggggg tggacaggat gtcaagtgct cccttggcta tttcccctgt gggaacatca 181 caaagtgctt gcctcagctc ctgcactgta acggtgtgga cgactgcggg aatcaggccg 241 atgaggacaa ctgtggagac aacaatggat ggtctctgca atttgacaaa tattttgcca 301 gttactacaa aatgacttcc caatatcctt ttgaggcaga aacacctgaa tgtttggtcg 361 gttctgtgcc agtgcaatgt ctttgccaag gtctggagct tgactgtgat gaaaccaatt 421 tacgagctgt tccatcggtt tcttcaaatg tgactgcaat gtcacttcag tggaacttaa 481 taagaaagct tcctcctgat tgcttcaaga attatcatga tcttcagaag ctgtacctgc 541 aaaacaataa gattacatcc atctccatct atgctttcag aggactgaat agccttacta 601 aactgtatct cagtcataac agaataacct tcctgaagcc gggtgttttt gaagatcttc 661 acagactaga atggctgata attgaagata atcacctcag tcgaatttcc ccaccaacat 721 tttatggact aaattctctt attctcttag tcctgatgaa taacgtcctc acccgtttac 781 ctgataaacc tctctgtcaa cacatgccaa gactacattg gctggacctt gaaggcaacc 841 atatccataa tttaagaaat ttgactttta tttcctgcag taatttaact gttttagtga 901 tgaggaaaaa caaaattaat cacttaaatg aaaatacttt tgcacctctc cagaaactgg 961 atgaattgga tttaggaagt aataagattg aaaatcttcc accgcttata ttcaaggacc 1021 tgaaggagct gtcacaattg aatctttcct ataatccaat ccagaaaatt caagcaaacc 1081 aatttgatta tcttgtcaaa ctcaagtctc tcagcctaga agggattgaa atttcaaata 1141 tccaacaaag gatgtttaga cctcttatga atctctctca catatatttt aagaaattcc 1201 agtactgtgg gtatgcacca catgttcgca gctgtaaacc aaacactgat ggaatttcat 1261 ctctagagaa tctcttggca agcattattc agagagtatt tgtctgggtt gtatctgcag 1321 ttacctgctt tggaaacatt tttgtcattt gcatgcgacc ttatatcagg tctgagaaca 1381 agctgtatgc catgtcaatc atttctctct gctgtgccga ctgcttaatg ggaatatatt 1441 tattcgtgat cggaggcttt gacctaaagt ttcgtggaga atacaataag catgcgcagc 1501 tgtggatgga gagtactcat tgtcagcttg taggatcttt ggccattctg tccacagaag 1561 tatcagtttt actgttaaca tttctgacat tggaaaaata catctgcatt gtctatcctt 1621 ttagatgtgt gagacctgga aaatgcagaa caattacagt tctgattctc atttggatta 1681 ctggttttat agtggctttc attccattga gcaataagga atttttcaaa aactactatg 1741 gcaccaatgg agtatgcttc cctcttcatt cagaagatac agaaagtatt ggagcccaga 1801 tttattcagt ggcaattttt cttggtatta atttggccgc atttatcatc atagtttttt 1861 cctatggaag catgttttat agtgttcatc aaagtgccat aacagcaact gaaatacgga 1921 atcaagttaa aaaagagatg atccttgcca aacgtttttt ctttatagta tttactgatg 1981 cattatgctg gataccCATT TTTGTAGTGA AATTTCTTTC ACTGCTTCAG GTAGAAATAC 2041 CAGGTACCAT AACCTCTTGG GTAGTGATTT TTATTCTGCC CATTAACAGT GCTTTGAACC 2101 CAATTCTCTA TACTCTGACC ACAAGACCAT TTAAAGAAAT GATTCATCGG TTTTGGTATA 2161 ACTACAGACA AAGAAAATCT ATGGACAGCA AAGGTCAGAA AACATATGCT CCATCATTCA 2221 TCTGGGTGGA AATGTGGCCA CTGCAGGAGA TGCCACCTGA GTTAATGAAG CCGGACCTTT 2281 TCACATACCC CTGTGAAATG TCACTGATTT CTCAATCAAC GAGACTCAAT TCCTATTCAT 2341 TGCCAACTTT CTTGTACAAA GTGGTTGATA TCGGTAAGCC TATCCCTAAC CCTCTCCTCG 2401 GTCTCGATTC TACGTAGTAA TGAACTAGTC CGTAACTGAA AGTATTTCGA TTTCTTGGCT 2461 TTATATATCT TGTGGAAAGG ACGAAACGAT TACCCTCGTC GGAACCGTAC GCGTTAAGTC 2521 gacaatcaac ctctggatta caaaatttgt gaaagatt